Как защитить от фитофторы картофель: Как защитить картофель от фитофтороза?

By alexxlab No comments

Содержание

Как защитить картошку от фитофторы

Фитофтороз картофеля – препараты и народные средства для борьбы с фитофторой

Уже более сотни лет на картошке хозяйничает фитофтора. Ежегодно огородники и фермеры теряют от нее до четвертой части своего урожая. При оптимальных условиях развития возбудителя болезни потери увеличиваются до 50-80%. Фитофтороз на картофеле приносит в мире огромные финансовые потери — каждый год в пределах 10 млрд евро. Несмотря на все усилия, человечество пока не нашло гарантированно успешных способов борьбы с ней, а заболевание получает все большее распространение. Сочетание опасного патогена, восприимчивой культуры и влажного климата приводит к взрывному развитию и распространению болезни.

Трудность борьбы заключается в том, что возбудитель в настоящее время способен к адаптации, постоянно мутирует, преодолевает устойчивость к новым фунгицидам. Порой и погодные условия способствуют дальнейшей жизнедеятельности и размножению возбудителя. Если раньше заболеванием поражался только листовой аппарат, то теперь инфекция спустилась на стебли и корнеплоды.

Картофель – это наш второй хлеб, без него редко обходится приготовление нашей обычной еды. Поэтому задача каждого огородника, не только вылечить пораженные растения, но и не допустить появление болезни на соседних овощах. Как это сделать, об этом дальше в статье.

Фитофтороз – что это за болезнь, что поражает

Фитофтора – это собирательное понятие многих грибковых заболеваний, возбудителем которых являются мицелиальные организмы, низшие грибы. В процессе своего развития они приспосабливаются к паразитическому образу жизни и проявляют патогенные свойства на многочисленных растениях – траве, деревьях, кустарниках.

Поражаются грибами чаще пасленовые – картофель, томаты, баклажаны. Но не редкость появления признаков болезни на перцах, луке, клубнике, капусте. И даже можно заметить признаки болезни на хрене. Симптомы болезни на всех культурах одинаковые, но заболевание называется на разных культурах по-разному. Так, например, у огурцов, лука и капусты – пероноспороз, на винограде – черная пятнистость или мильдь, у картофеля – серая гниль.

Фитофтора картофеля – признаки, как выглядит, фото листьев

Поскольку сегодня речь пойдет конкретно о фитофторе на картофеле, то будем говорить о признаках болезни и как именно бороться с инфекцией на этом главном овоще нашего стола.

Источник болезни – это грибница с фитоспорами, которая обитает в почве. Для ее дальнейшей жизнедеятельности и размножения необходимы определенные условия. Частые моросящие дождики, чередующиеся с солнечной погодой в середине дня, прохладные ночи и обильные росы – вот что надо для быстрого ее роста. С помощью ветра, некоторых насекомых (мошек) споры мицелия с больного растения переносятся на другие кусты.

Признаки болезни на картошке уже начинаются в начале сезона и проявляются в течение лета в зависимости от погодных условий:

  • температуры и влажности воздуха,
  • устойчивости сорта к фитофторозу,
  • степени зараженности почвы.

Во влажное дождливое лето пораженные растения можно заметить в середине лета, в сухое лето — ближе к осени.

Сначала на стеблях и листьях зараженных растений появляются небольшие темно-бурые пятнышки, которые очень быстро увеличиваются в размерах.

Иногда на пораженных листьях можно заметить серый налет – это споры.

Постепенно листья чернеют, стебли засыхают и отмирают.

Если не предпринять никаких мер, но патогенный процесс обратно уходит в почву, поражая там клубни. Они в лучшем случае не набирают массу, теряют потребительские свойства. В противном — начинают гнить уже в земле.

На разрезе больных картофелин видны участки пораженной ткани. Такой овощ уже не пригоден в пищу, а при хранении он начинает быстро гнить и поражать гнилью соседние клубни.

Чем опасна фитофтора для картофеля и человека

Главная опасность болезни именно в ее быстром распространении, она размножается в геометрической прогрессии. Споровые формы (ооспоры) довольно живучие, они имеют плотную оболочку и поэтому легко переносят низкие и высокие температуры. И не погибают в почве в течение 3-4 лет, а то и дольше.

В XX веке фитофтора активизировалась при потеплении свыше +8 градусов, почти замирая при +24 и выше. Болезнь XXI века вредоносна в более широком температурном диапазоне – от +3 до + 27 градусов.

Попадая в благоприятную среду (умеренная температура и влажность), ооспоры прорастают в конидии, которые легко разносятся ветром и дождем на соседние растения, поражая все большие площади на участке. В теплой влаге конидии быстро прорастают в подвижные зооспоры, которые внедряются в ткани растения и начинают там паразитировать, постепенно их разрушая. В результате листья чернеют, нарушается питание всего растения, в том числе и зарождающихся клубней.

Фитофтора на картофеле – это входные ворота для различных гнилей на других растениях. Больше всего страдают помидоры и баклажаны. Стараясь спасти урожай, огородникам приходится применять различные химикаты, что ведет к их накоплению в овощах. Употребляя овощи с такой добавкой, вряд ли они принесут пользу для здоровья.

Лечение картофеля от фитофторы – препараты для обработки в открытом грунте

При фитофторе болезнь начинается с нижних листьев. И если вы уже заметили первые бурые точечки и пожелтение нижних листочков немедленно приступайте к обработке растений.

Важно проводить опрыскивание растений, тщательно орошая нижние листья и стебель, ну а верхние листья — само собой.

Чем можно обработать картошку? Существуют контактные и системные фунгициды. Контактные – дешевле, но если ими обрабатывать в дождливое лето, то придется провести минимум 6 обработок. Один-два легких дождичка или один сильный ливень сведут все усилия на нет. Поэтому лучше использовать системные, они подороже, но надежные. Из системных можно использовать фунгициды фирмы Байер Консенто и Инфинито.

Консенто

Препарат активизирует рост растений, оберегает их от различных инфекций и оказывает лечебное воздействие. Применяется как для профилактики, так и для лечения заболеваний на различных стадиях развития. Среди его достоинств:

  • эффективен на разных стадиях развития заболевания и на всех этапах роста растения;
  • дает быстрый и длительный эффект;
  • минимальная вероятность привыкания патогена к средству;
  • не смывается при поливах и дождях длительное время.
Инфинито

Системный фунгицид, в составе активные действующие вещества — флюопиколид и пропамокарб гидрохлорид. После попадания флюопиколида на растение, средство по межклеточным промежуткам проникает внутрь ткани и вызывает гибель подвижных зооспор и дальнейшее развитие мицелия. А пропамокарб гидрохлорид действует, как стимулятор роста. Защитное действие препарата длится до двух недель, в зависимости от степени инфицированности и погодных условий. Кроме того средство

  • обладает кратковременным токсическим действием,
  • не токсичен для птиц, пчел, дождевых червей, для обитателей водоемов;
  • повышает урожайность картофеля.
Квадрис

Средство швейцарского производства. Активное действующее вещество — азоксистробин. Он разрушает грибок и не дает ему распространяться. Обладает широким спектром действия, губительно действует на все грибы за исключением полезных. Кроме того,

  • не оказывает губительного влияния на окружающую среду, не накапливается в листьях и соответственно в плодах;
  • безопасен для полезной почвенной микрофлоры и ее обитателей;
  • не препятствует другим биопрепаратам повышать плодородие почвы;
  • большая часть препарата после обработки остается в виде несмываемой пленки, то есть является и контактным, и системным препаратом.
Энергодар-Укравит

Новейший фунгицид украинского производства с ростостимулирующими свойствами для защиты овощных и бахчевых культур от комплекса опасных болезней. Активное действующее вещество — пропамокарб гидрохлорид и фосетил-алюминия. Применяют, когда какие-либо профилактические мероприятия проводить уже поздно.

Преимущества препарата:

  • Оказывает положительное влияние на укрепление иммунитета растения и стимулирует его рост;
  • Не вызывает привыкания патогенов к препарату;
  • Обеспечивает защиту необработанных частей растений и нового прироста;
  • Удобен в применении в течение всего периода вегетации.

Применяя препараты для профилактики и лечения фитофторы на картофеле, перед использованием внимательно читайте инструкцию. При обработке пользуйтесь средствами защиты.

Как избавиться от фитофторы на картошке

Фитоспорин

Прекрасное средство для профилактики фитофтороза. Опрыскивание растений начинают проводить с середины мая, когда растения достигнут высоты не более 20 см. Учитывайте, что пик болезни начинается с середины июня, а когда проявятся первые признаки обработку фитоспорином проводить уже поздно.

Сначала из пасты делают маточный раствор. Не допустите ошибки при приготовлении раствора. Из маточного раствора готовят рабочий раствор. Для этого 2 ст. л. маточного раствора разводят в 10 л воды и проводят опрыскивание. Профилактическое опрыскивание проводят в фазе смыкания рядков. Повторную обработку проводят через 7-10 дней. Повторную обработку нужно провести обязательно, так как живым бактериям фитоспорина необходимо оккупировать все пространство почвы и начать бороться с фитофторой.

Проводите обработку тогда, когда под растениями нет сорняков. Иначе часть средства будет попадать на сорняки, а не на растение.

Медный купорос

До цветения обработку проводят 1% раствором медного купороса (2 ст. л. на 10 л воды, но не больше!). Для профилактики опрыскивают 1 раз. Если заболевание уже появилось, обрабатывают 2-3 раза за сезон. За 2 недели до сбора урожая опрыскивание прекращают. На ботве, опрыснутой медным купоросом, конидии не могут прорастать и заражать другой картофель.

Бордосская жидкость

Фитофтора живет в почвах, бедных медью. Поэтому при первом окучивании можно сделать профилактическое опрыскивание бордосской жидкостью, которая в своем составе также имеет медь, сдерживающая рост фитофторы. Она труднее смывается дождем, защищает картофель в течение недели.

Вторую обработку проводят при появлении первых признаков болезни, следующую, третью, через неделю.

Прилипатели (жидкое мыло) можно добавлять, когда идут частые дожди. В сухую погоду обходятся без них, либо капнуть 1-2 капли жидкого мыла на 10 л воды.

Народные средства от фитофторы на картофеле

Хорошо зарекомендовало применение молочной сыворотки с йодом в борьбе с фитофторозом. Раствор готовится следующим образом. 2 л молочной сыворотки (лучше перебродившей в теплом месте) + 20 капель настойки йода и разводят все до 10 л воды. Обрабатывать можно не только картофель, но и помидоры, баклажаны, огурцы и т. д. Опрыскивают 1 раз в неделю. Если идут дожди и понижается температура, опрыскивают чаще – каждые 4 дня.

Обработку проводят ранним утром и поздно вечером, чтобы не было жарко. Чтобы за 0,5-1 час на растениях до жары раствор не высох и проник внутрь листа и начал свое действие.

3-я обработка – дрожжевая подкормка. На 10 л берут 100 г прессованных дрожжей или 50-60 г сухих. Для активизации процесса дрожжи сначала разводят в небольшом количестве теплой воды с добавлением 1-2 ст. л. сахара. Через 1-2 часа закваску выливают в теплую воду и рабочий раствор для подкормки готов. Дрожжевые грибки подавляют рост патогенных грибов, и являются стимулятором роста. Подкормку дрожжами проводят 1 раз в 10 дней, если жарко, в дожди – каждые 4 дня. Для проведения подкормки на больших площадях используют мелкодисперстные распылители.

Профилактика фитофтороза и что делать с картофельной ботвой

Чтобы защитить картофель от фитофторы, важно своевременно проводить профилактические мероприятия на разных этапах выращивания вплоть до уборки урожая. Лучше предупредить заболевание на начальных стадиях, чем потом потратить больше времени и средств на лечение.

  1. Фитофтора появляется во второй половине лета, поэтому сейчас многие огородники отдают предпочтение ранним сортам. Такие сорта как раз успевают созреть до ее появления.
  2. 2-3 раза за сезон необходимо окучивать картофель. Это делается не только для создания придаточных корней и улучшения питания растения. Дело в том, что высокое окучивание препятствует смыканию растений и этим можно предотвратить заражение соседних кустов. А также вода скапливается в углублениях между рядками, тем самым влага скапливается у корней, н не на листьях растений.
  3. При посадке картошки не загущайте посадки. Оставляйте достаточно места между рядками для хорошей вентиляции. При загущенных посадках сохраняются условия для размножения фитофторы. Оптимальная ширина между рядками не менее 70 см, а в некоторых случаях и более. Такой прием поможет избежать заражения в дождливое лето.
  4. В период цветения нельзя подкармливать органическими удобрениями, так как органика тоже может дать толчок для развития фитофторы.
  5. За 2 недели до уборки урожая, ботву срезают, чтобы зооспоры с ботвы не перешли на клубни. Всю ботву убирают с участка или лучше ее сжечь. Кроме того, этот прием делает толстой кожуру клубня, поэтому картофель будет лучше хранится зимой.
  6. Соблюдайте севооборот. По возможности меняйте местами овощные культуры, в том числе и картофель. Желательно повторно высаживать на это место овощи лишь через 3-4 года. Ежели такой возможности нет, выбирайте семенной материал, устойчивый к фитофторе.

Дорогие читатели, вот те немногие средства для профилактики и лечения фитофтороза. Может быть, вы знаете еще какие-то другие средства и способы, тогда напишите о них в комментариях. Буду вам признательна.

Хороших вам урожаев!

Правильная стратегия борьбы с фитофторозом картофеля

Фитофтороз на листьях картофеля

Потери урожая и качества особенно высоки, если фитофтороз появляется до или после закрытия ряда, соответственно, как так называемый фитофтороз.

Следовательно, основной задачей тех, кто работает на этом поле, должно быть предотвращение заражения картофельного поля как можно дольше. Действительно, погода, на которую мы не можем повлиять, играет решающую роль в начале и развитии инфекции. Тем не менее, фермер, выращивающий картофель, может принять ряд мер, чтобы снизить уровень заражения.

Опытные фермеры знают, что планирование первого применения фунгицида и соответствующего продукта решает успех борьбы с фитофторозом. В зависимости от количества осадков с мая до середины июня первое опрыскивание может потребоваться до закрытия рядков картофеля, а также значительно позже. Опрыскивание фунгицидами следует начинать за 7 — 12 дней до появления на участке фитофтороза.Кроме того, для экономической эффективности лечения важно, чтобы выбор продукта соответствовал давлению инфекции. Предупреждения и осмотр урожая являются важными инструментами для своевременного планирования внесения фунгицидов.

Почему влажность почвы актуальна для фитофтороза?

Возбудитель фитофтороза (Phytophtera infestans) зимует в латентно (незаметно) инфицированных клубнях картофеля. Когда этот картофель весной начинает расти, грибок распространяется на стебель.Обширные исследования в Баварском государственном исследовательском центре сельского хозяйства (LfL) в последние годы показали, что при высокой влажности почвы возможен другой путь заражения (рис. 1). Споры развиваются на пораженном клубне и распространяются через почвенную воду. Так могут заразиться соседние растения или стебли одного растения. Они вырастут и больными, и разовьются типичные гнезда фитофторы. В обоих случаях растения очень рано обнаруживают заражение стебля (начальное заражение).Вот почему в годы с засушливой погодой весной значительно ниже начальное заражение и, следовательно, меньше влияние инфекций, чем во влажные годы. Но и тип почвы косвенно влияет на развитие болезни. Легкие почвы быстрее отводят воду, и опасность раннего и сильного заражения значительно ниже, чем на суглинистых почвах. Участки с высоким уровнем грунтовых вод и районы с большим количеством осадков особенно подвержены опасности очень раннего и массового заражения стеблей.

Брызги ветра и дождя обеспечивают распространение спор Phytophthora, образовавшихся на инфицированном стебле.Но в конце концов погода (оптимальная: не менее 4 часов влажных листьев и 15-20 градусов Цельсия) решает, насколько сильным будет заражение листьев (вторичное заражение). Кроме того, на дальнейшее распространение болезни в культуре влияет скорость роста ботвы картофеля, которая зависит от сорта и расхода азотных удобрений. Пышная ботва картофеля создает благоприятный микроклимат для урожая и, следовательно, представляет более высокий риск (рис. 1).

Устраните источник заражения!

Что могут сделать те, кто работает в этой сфере? Фермеры, обработавшие свой семенной картофель купрозином, прогрессируют в борьбе с бактериальной мягкой гнилью (Erwinia) с помощью метода ULV (орудие Mantis), могут рассчитывать на побочный эффект против начальной инфекции (стеблевой инфекции) фитофторы.Это важный шаг для отсрочки появления фитофтороза на посевах картофеля, как показывают текущие исследования LfL. Кроме того, разумной фитосанитарной мерой является вывоз добровольцев из картофеля и отвалов мусора. Очень важно начать опрыскивание от фитофтороза в нужный момент. Это должно произойти примерно за неделю до видимого начального заражения на участке. Слишком раннее лечение приводит к расходам, но не дает эффекта от болезни. Лечение, проведенное слишком поздно, часто не дает достаточного эффекта.Прогнозирование фитофтороза, предлагаемое официальной службой защиты растений, является важным инструментом для определения оптимального момента для первого опрыскивания. Эта информация доступна на сайте www.LfL.Bayern.de в Баварии и на www.ISIP.de в большинстве других земель Германии. Однако полагаться исключительно на рассчитанный прогноз недостаточно. Другие факторы, такие как местные особенности погоды или колебания влажности почвы, вызванные, например, высоким уровнем грунтовых вод, также должны быть приняты во внимание.Поэтому проверка собственных посевов картофеля на наличие первичных стад и ранних инфекций по-прежнему является обязательной и должна проводиться один или два раза в неделю, начиная с трех недель после появления всходов картофеля и в зависимости от нагрузки инфекции (модель прогнозирования).

У каждого фунгицида против фитофтороза есть свои сильные и слабые стороны. Поэтому важно выбрать наиболее эффективный продукт в зависимости от текущих условий. Поскольку эпидемии фитофтороза каждый год различаются (как показано выше), выбор подходящих продуктов также должен быть пересмотрен и скорректирован.По этой причине важно знать сильные и слабые стороны фунгицидов. Кроме того, опытный фермер при выборе продукта будет учитывать влияние фитофтороза и фазу роста. Можно выделить следующие разделы.

Начало опрыскивания:
Как уже упоминалось выше, цель первой обработки фунгицидами — уменьшить рост грибка от клубня до стебля картофеля. На тяжелых почвах опрыскивание в основном следует начинать с системных продуктов (Infinito, Ridomil Gold MZ, Epok, Fantic M WG, Proxanil Extra, Ranman Top-Proxanil Pack).Эти продукты проникают в ткань стебля и захватывают грибок, когда он растет вверх. Если риск заражения семенного картофеля сохраняется (например, сохраняется высокая влажность почвы), совершенно необходимо также использовать системный продукт для второй обработки. Из-за частой устойчивости к металаксилу Infinito или Ranman Top-Proxanil Pack необходимо использовать в следующих случаях, если при первой обработке применялся продукт, содержащий металаксил или беналаксил (Ridomil Gold MZ, Epok, Fantic M WG). Ридомил Голд MZ, Epok и Fantic M WG также нельзя применять, если на посевах картофеля проявляются первые симптомы фитофтороза. До сих пор Infinito не образует сопротивлений, и, поскольку продукт имеет низкий риск потери эффективности, его можно применять несколько раз. Начать опрыскивание контактным средством рекомендуется только на легких почвах вместе с сухой родниковой.

Основная фаза роста:
На этом этапе ботва картофеля растет так быстро, что уже через несколько дней после обработки площадь незащищенных листьев значительно увеличилась.При высоком давлении фитофтороза особенно высок риск заражения недостаточно защищенных листьев. В этих условиях рекомендуется использовать местные системные или частичные фунгициды соответственно. Эти продукты проникают в листья и также могут в определенной степени защищать новые листья, а также есть эффект, если грибок уже проник в ткань (защитный и лечебный эффект). Но следует учитывать, что эти продукты могут остановить болезнь только в течение 48 часов после заражения даже при полной норме применения. Инфекции, которые возникли дольше, или видимые заражения невозможно остановить.

Согласно нашему опыту, продукты, содержащие цимоксанил (Curzate M WG, Nautile WP, Tanos, Zetanil M), обладают лучшим лечебным эффектом (стоп-эффектом). По этой причине эти фунгициды особенно подходят для остановки опрыскивания (существует спорулирующий фитофтороз), тогда, однако, используйте баковую смесь с полной нормой внесения фунгицидов, содержащих флуазинам. Если погодные условия продолжают быть благоприятными для болезни, опрыскивание необходимо повторить через четыре-шесть дней.Недостатком фунгицидов, содержащих цимоксанил, является более короткий период действия, составляющий два-три дня, по сравнению с другими частичными препаратами системного действия. Если не хотите столкнуться с неприятным сюрпризом в период высокого фитофтороза, это следует учитывать.

Как только рост листьев прекращается, начиная с периода цветения, также флуазинамсодержащие фунгициды, Ranman Top, Shaktis и Electis, достигают хороших результатов при высоком и среднем уровне заражения. Поскольку активное вещество манкоцеб, один из двух компонентов Electis, повторно растекается по поверхности листьев вместе с росой, этот продукт можно наносить в течение длительного периода.

В фазах низкого давления фитофтороза, независимо от стадии развития картофеля, защита от фитофтороза может быть в достаточной степени обеспечена экономичными контактными фунгицидами на основе активных веществ манеб, манкоцеб или метирам. Эти фунгициды также повторно распространяются на листьях вместе с росой и поэтому могут в определенной степени защитить новые листья. В отличие от Ширлана и Ранмана, эти контактные продукты также обладают хорошим действием против альтернариоза. Это важно для позднеспелых и / или восприимчивых к альтернариозу сортов (Курас) в периоды погоды, когда часто чередуются высокие температуры и дожди.

Созревание и завершающая обработка:
Как только ботва картофеля перестает расти, а нижние листья желтеют, важна защита клубней от фитофтороза. При видимом поражении фитофторозом рекомендуется в основном применять фунгициды со споровым действием (фунгициды, содержащие флуазинам, Ранман Топ). Даже без заражения есть польза от последнего опрыскивания одним из этих двух фунгицидов.

Споры фитофторы образуются, пока существует зеленая ботва картофеля.Через ветер, росу и капли дождя они достигают почвы и остаются заразными около трех недель. Наибольший риск заражения клубней (фитофтороза) возникает во время подъема. Причина: для успешного заражения споры должны непосредственно контактировать с клубнями, а поверхностные повреждения способствуют проникновению фитофтороза в клубни. Чтобы обеспечить наилучшую защиту от фитофтороза во время подъема, целесообразно объединить закрывающую обработку с химическим уничтожением ботвы картофеля примерно за три недели до подъема.

Сравнение контактных и системных фунгицидов против фитофтороза

Не мало воды

Важно полностью увлажнить растения. Многие фермеры недооценивают влияние расхода воды на результаты контроля. Согласно нашим экспериментам, для достижения максимальной эффективности фунгицида необходимо 400 л воды / га. Только на слаболиственных культурах (до закрытия ряда и после начала созревания) можно обойтись 300 л / га.Однако при сильном листве (основная фаза роста и / или сорта с сильно развитой листвой) рекомендуется 500 л / га.

Провести процедуры в утренний час

В какое время суток следует проводить фунгицидные обработки? Это часто задаваемый вопрос. При этом действует следующее: системные активные вещества должны активно усваиваться растением. Растения картофеля, страдающие от жары или засухи, не могут этого сделать.Поэтому в период хорошей погоды фунгициды необходимо применять ранним утром. Благоприятно, если растения будут влажными от росы. Утро также оптимально для нанесения контактных продуктов. Поскольку контактные фунгициды остаются на поверхности листьев, обработка также возможна в ранние вечерние часы. В полдень и после полудня риск сноса ветра особенно высок из-за усиленного движения воздуха (в том числе от поверхности земли вверх). По этой причине в это время нельзя проводить никаких процедур.Более подробная информация о фунгицидах против фитофтороза и важные условия применения содержатся в pdf-документе «Фунгициды для борьбы с фитофторозом».

.

Как спасти картофель от фитофтороза | Home Guides

Фитофтороз, грибковое заболевание, вызываемое патогенами Phytophthora infestans и Alternaria solani, приводит к сморщенным, коричневым листьям и поражениям на стеблях растений. На поздних стадиях болезнь распространяется на клубни. Клубни приобретают коричневато-красный цвет, который начинает расти под кожицей. Гниль вскоре приводит к гниению картофеля. Гниль обычно развивается в периоды высокой влажности и при температуре от 55 до 85 градусов по Фаренгейту.Принятие мер предосторожности может помочь предотвратить бактериальный ожог картофеля, но если ваши растения уже заражены, можно вылечить болезнь и сохранить часть урожая.

Предотвратить бактериальный ожог картофеля

Выращивайте сорта картофеля, которые менее восприимчивы к фитофторозу, такие как Рассет Бербанк, Чипета, Сарпо и Легенд.

Сажайте картофель в хорошо дренируемую почву, чтобы предотвратить накопление влаги и гниение. Избыточная влажность вызывает развитие грибкового заболевания.

Защитите растения картофеля от продолжительных периодов дождя, накрыв их прозрачными поливиниловыми листами.Подоприте листы по бокам, чтобы обеспечить циркуляцию воздуха.

Удалите сорняки, которые могут служить переносчиками болезней, таких как паслен волосатый. Сорняки также могут ограничивать циркуляцию воздуха, создавая благоприятные условия для развития болезней растений.

Опрыскайте растения картофеля фунгицидом, например мефеноксамом, цимоксанилом или диметоморфом, до развития фитофтороза. Покройте листву и стебли всех растений в саду.

Перед поливом или поливом дайте листву картофеля полностью высохнуть.Избегайте попадания воды на стебли и листья. Если листья остаются влажными в течение восьми — 10 часов, на растении прорастут споры фитофтороза.

Борьба с фитофторозом

Избавьтесь от инокулята или источников фитофтороза. Источники включают зараженные клубни, растения-добровольцы и кучи выбраковки. Утилизируйте материал, закопав или сжигая его.

Средства дезинфекции, которые вы использовали для работы с зараженным картофелем. Для дезинфекции смешайте 9 частей воды с 1 частью отбеливателя, затем погрузите инструменты в раствор как минимум на 60 секунд.Это предотвращает распространение болезни.

Урожай картофеля раньше, чем наступит болезнь, может заразить все растение. Перед сбором урожая срежьте у растений верхушки и выбросьте их. Подождите две-три недели перед сбором клубней.

Нанесите фунгицид на листья и стебли инфицированных растений и продолжайте обработку каждые 7-10 дней до сбора урожая. Лучше всего использовать фунгициды как можно раньше.

.

Фитофтороз томатов и картофеля

Факты

  • Фитофтороз — потенциально разрушительное заболевание томатов и картофеля, поражающее листья, стебли и плоды томатов.
  • Болезнь быстро распространяется по полям и при отсутствии лечения может привести к полному неурожаю.
  • Фитофтороз картофеля стал причиной картофельного голода в Ирландии в конце 1840-х годов.

Хозяин и патоген

Фитофтороз поражает листья, стебли и плоды

Фитофтороз вызывается оомицетом Phytophthora infestans .Оомицеты — это грибоподобные организмы, также называемые водяной плесенью, но это не настоящие грибы.

Существует множество различных штаммов P. infestans . Они называются клональными линиями и обозначаются числовым кодом (например, US-23). Многие клональные линии влияют как на помидоры, так и на картофель, но некоторые линии специфичны для одного хозяина или другого.

Диапазон хозяев обычно ограничен картофелем и помидорами, но паслен волосатый ( Solanum physalifolium ) является близкородственным сорняком, который может легко инфицироваться и способствовать распространению болезни.В идеальных условиях, например в теплице, петуния тоже может заразиться.

Идентификационный номер

Признаки и симптомы

Инфекция на листьях — большие коричневые пятна с зеленовато-серым краем.

  • На листьях большие темно-коричневые пятна с зеленовато-серым краем; не ограничен крупными жилками листа.
  • Инфекция распространяется через листочки и черешки, в результате чего образуются большие участки сухой коричневой листвы.
  • Стволовые инфекции твердые, темно-коричневые, с закругленными краями.
  • Прочные темно-коричневые круглые пятна покрывают большую часть плодов. Пятна могут стать мягкими из-за вторжения вторичных бактерий.
  • В условиях высокой влажности на пораженных листьях, плодах и стеблях появляются тонкие порошкообразные белые грибковые образования. Зараженные плоды имеют сухую коричневую гниль При высокой влажности на инфицированных плодах, листьях и стеблях образуются порошкообразные белые споры
  • В прохладную влажную погоду целые поля становятся коричневыми и увядают, как от мороза.
Окружающая среда
  • Наибольшее распространение в прохладную (от 60 ° F до 70 ° F) влажную погоду.
  • Продолжительные жаркие засушливые дни могут остановить распространение патогенов.

Биология и цикл болезней

Phytophthora infestans может перезимовать в Миннесоте, если он защищен кучами для выбраковки картофеля. Перезимовка в системе выращивания томатов маловероятна, но зараженные плоды томатов могут дать начало зараженным всходам добровольцев в следующем сезоне.

Наиболее распространенными путями заноса каждый сезон являются зараженные семенные клубни картофеля, инфицированные трансплантаты томатов, доставленные из других регионов, или спорангии, переносимые ветром (бесполые споры) с юга.

В прохладных влажных условиях P. infestans может инфицировать и производить тысячи спорангиев на поражение менее чем за пять дней. Эти спорангии легко переносятся воздухом, что приводит к обильному распространению возбудителя.

Заболевание потенциально может уничтожить целые поля за короткий период времени, если не лечить. Также вероятно распространение на другие поля на большие расстояния, особенно в пасмурную погоду.

Менеджмент

Устойчивые сорта

Даже устойчивый сорт проявляет некоторые симптомы фитофтороза, когда условия очень благоприятны для болезни.Уровни устойчивости различаются между сортами и могут быть более или менее эффективными в зависимости от присутствующей клональной линии P. infestans . Ниже перечислены несколько устойчивых разновидностей. Проверьте каталоги семян и веб-страницу Cornell vegMD на предмет новых сортов, устойчивых к фитофторозу.

Сорта томатов, устойчивые к фитофторозу: Mountain Magic (F1), Plum Regal (F1), Defiant PhR (F1), Mountain Merit (F1), Iron Lady (F1), Jasper (F1), Red Pearl (F1), Legend, Matt’s Wild Cherry, Wapsipinicon Peach, Lemon Drop, Pruden’s Purple

Культурный контроль
  • Уничтожьте груды отбракованного картофеля до начала вегетационного периода, закопав их, разложив и заделав на поля или скармливая животным.
  • Контролировать всходы картофеля-добровольцев, так как инфицированные растения могут расти из инфицированных клубней.
  • Заражение семян коммерчески подготовленных семян томатов или сохраненных семян, которые были тщательно высушены, маловероятно.
  • Перед покупкой и / или посадкой проверьте пересадку томатов на наличие симптомов фитофтороза, так как пересадки томатов, отправленные из южных регионов, могут быть инфицированы.
  • Если инфекция обнаружена только на нескольких растениях в пределах поля, инфицированные растения следует удалить, отсеять, убить гербицидом или уничтожить пламенем, чтобы избежать распространения по всему полю.
Химический контроль

Имеются фунгициды для борьбы с фитофторозом томатов. Фитофтороз случается в Миннесоте не каждый год. Производители должны следить за симптомами фитофтороза при регулярном осмотре, особенно при погодных условиях, благоприятствующих болезни. Отчеты о региональных вспышках фитофтороза можно найти на веб-сайте USAblight.

Обработка фунгицидами должна производиться до заражения, когда условия окружающей среды благоприятствуют наиболее эффективному заболеванию. Phytophthora infestans — это водная плесень, а не настоящий гриб. Необходимо использовать фунгициды, специфичные для водных форм, и повторять нанесение в соответствии с инструкциями на этикетке. Текущий список фунгицидов для борьбы с фитофторозом можно найти в Руководстве по производству овощей Среднего Запада. Вращайте фунгицидные группы и / или фунгициды в баковой смеси, чтобы избежать образования устойчивых к фунгицидам изолятов.

Поскольку развитие фитофтороза очень сильно зависит от погоды, были разработаны компьютерные программы прогнозирования болезней, такие как TOM-CAST, чтобы определить, когда патоген наиболее активен.Программа использует данные о температуре, влажности и осадках с метеостанции. Программа определит необходимость применения фунгицида. Использование этой системы вместо простого применения фунгицидов каждые 7 дней может сэкономить несколько опрыскиваний фунгицидами за сезон, при этом обеспечивая хороший контроль над болезнями.

Анна Джонсон; Мишель Грабовски, педагог-консультант, и Анжела Оршински, патолог-консультант

.

Причины, идентификация, лечение фитофтороза картофеля

Фитофтороз — самая серьезная проблема, с которой сталкивается производитель картофеля. Прибыв, она может уничтожить урожай за день или два, а когда инфекция переместится с листвы на клубни картофеля, они тоже загниют.

Картофель, пораженный фитофторозом, сморщенный снаружи, покрытый пробкой и сгнивший внутри. Он также воняет и, однажды пахнув, никогда не забывается.

Наиболее известно, что фитофтороз картофеля был, если не единственной причиной, безусловно, основным виновником голода в Ирландии 1840-х годов.

Болезнь началась в Европе и в конечном итоге достигла Ирландии, где картофель был основным продуктом питания. Что еще хуже, все ирландцы выращивали один и тот же очень восприимчивый сорт (ирландский лампер). Они не только потеряли урожай на земле, но и запасы урожая были потеряны.

Голод в Ирландии преподал урок садоводам. Отсутствие генетического разнообразия и монокультурности увеличивает риск опустошения. К сожалению, фермеры игнорируют это на свой страх и риск.

Причина фитофтороза

Фитофтороз вызывается грибком Phytophthora infestans. Этот гриб может также инфицировать других членов семейства картофельных пасленовых, например томаты.Он распространяется воздушно-капельным путем на ветру до тех пор, пока не приземлится на уязвимое растение, и погодные условия будут подходящими для его развития, теплыми и влажными.

Зараженный картофель короля Эдуарда в июле.
Сегодня ботва в порядке, завтра — потемнела и явно умирает.

Находясь рядом с другими производителями картофеля, вы увеличиваете риск, так как вокруг больше спор, но даже производители в изолированных местах, где нет картофеля поблизости, уязвимы.

Если вы какое-то время выращивали и думаете, что фитофтороз картофеля усиливается, вы правы.Это по двум причинам.

Сначала погода. В последние годы зима в Великобритании стала теплее, а лето более влажным. Условия для заражения более благоприятны, чем раньше. Неважно, является ли это долгосрочным эффектом изменения климата или просто статистической случайностью — факт в том, что погода благоприятствует упадку.

Во-вторых, у нас больше разновидностей гнили, чем раньше. До 1990-х годов у нас был в основном один штамм фитофтороза, который со временем изменялся, преодолевая устойчивые к фитофторозу сорта картофеля.Затем еще один штамм гнили был завезен партией картофеля из Мексики.

Два штамма смешались и воспроизвели, таким образом получив больше штаммов, и в настоящее время в Великобритании существует 4 или 5 вариантов фитофтороза картофеля. Очень похоже на то, как развивается грипп. Один год мы болеем гонконгским гриппом, а в следующем — другой тип, поскольку вирус мутирует. Надеюсь, у нас не будет чумной версии испанского гриппа 1919 года, который убил больше людей, чем первая мировая война.

Периоды Смита и Хаттона

Теплые и влажные условия, идеальные для развития фитофтороза, официально определены и известны как периоды Смита. «Период Смита» — это 48-часовой период, в течение которого минимальная температура составляет 10 ° C или более, а относительная влажность превышает 90% в течение как минимум 11 часов в течение первых 24 часов и как минимум 11 часов снова в течение последних 24 часов. .

Недавно вошла в употребление новая, более простая мера риска фитофтороза, известная как период Хаттона. Полный период хаттона наступает, когда в течение 2 дней подряд выполняются следующие критерии:

  • Минимальная температура воздуха 10 ° C
  • Относительная влажность 90% или выше в течение не менее 6 часов

Наблюдая за периодами Смита или Хаттона, можно предсказать, когда наиболее вероятно появление упадка, и использовать это предупреждение, чтобы производители приняли профилактические меры.Вы можете получать автоматические предупреждения о периодах Хаттона, отправленные прямо на ваш почтовый ящик, подписавшись на веб-сайт Blightwatch.

Симптомы картофельного ожога

Первоначальный симптом картофельного ожога — маленькие коричневые пятна на листьях, подобные этому.

Первоначально спора или, что более вероятно, несколько спор попадут на ботву картофеля. В засушливую погоду они спят, но при хорошей влажности грибок начинает расти. Вы можете заметить коричневые веснушки на листьях или участках листьев с коричневыми пятнами и своего рода желтоватой каймой, идущей от коричневого пятна.

При серьезном приступе вы можете обнаружить, что вся листва опускается, становится коричневой и начинает гнить. Страшно, как быстро может распространиться фитофтороз в определенных обстоятельствах.

Споры фитофтороза упадут или вымываются дождем на почву и открытые клубни. Попав в клубень, он распространится от клубня к клубню и заразит весь урожай.

Клубни, пораженные фитофторозом (настоящий картофель), можно определить по темным пятнам на коже. Если разрезать картофель пополам, по кожуре будет распространяться коричневатая гниль.В конце концов картофель почти разжижается, становится желеобразным и выделяет характерный запах. Безошибочный запах гнили.

Если вы храните картофель, запах действительно может помочь идентифицировать зараженный картофель, когда еще мало что можно увидеть. В хороший солнечный день разложите картофель на циновке снаружи. Вы заметите, что мухи устремляются к зараженному картофелю.

Профилактика и лечение картофельного упадка

Устойчивые к болезням Сарпо Мира не подвержены действию болезней.
Фотография сделана в то же время, что и картофель короля Эдуарда выше

Фитофтороз, как правило, погибает в холодную погоду, хотя с появлением новых гибридных штаммов некоторые признаки лучше справляются с перезимовкой. Основной резервуар болезни — зараженные клубни в земле или в мешках для хранения. Откуда бы они ни пришли, споры могут путешествовать на многие мили по ветру, и вы мало что можете сделать, если погода подходит для борьбы с болезнями.

У фермеров есть ряд химикатов для опрыскивания своих огромных площадей монокультурного картофеля, но химикаты, доступные нелицензированным домашним производителям, более ограничены. Фактически, сейчас они недоступны домашним производителям. Даже при повторяющихся еженедельных опрыскиваниях ужасным дождливым летом 2012 года многие фермеры все равно проиграли битву из-за чумы.

Традиционным средством для опрыскивания фитофтороза является бордосская смесь. Я не уверен, что это такая хорошая идея, поскольку он содержит медь и вряд ли подходит для вашей диеты, хотя был одобрен органическими веществами. Стоит уточнить у поставщиков садоводства, какие противогрибковые средства в настоящее время доступны и одобрены для использования на картофеле, поскольку список с каждым годом сокращается.

Если вы полагаетесь на распыление, то оно должно быть скорее профилактическим, чем лекарственным средством. Когда сообщается о периоде Смита или Хаттона, вы опрыскиваете и при первых признаках бактериального ожога, поражающего ботву, удаляйте пораженную листву и опрыскивайте оставшуюся часть. Это может сойти с рук, если поражены только несколько листьев, есть хороший шанс отразить упадок сил.

Если, однако, вы не выигрываете или не хотите использовать химические спреи, срежьте ботву и выбросьте ее. Вы можете залить ботву горячим компостом, но самый безопасный ответ — выбросить или сжечь ее.Клубни картофеля не разовьются, но оставьте их на 3 недели. Мы надеемся, что это предотвратит попадание спор фитофтороза на клубни во время сбора урожая.

После сбора урожая и хранения регулярно проверяйте картофель на наличие признаков бактериального ожога и сразу же удаляйте все подозрительные клубни из магазина.

Надлежащая практика помогает предотвратить бактериальный ожог картофеля
  • Обязательно вытащите из земли весь картофель, даже самый крошечный, если можете, чтобы не оставить резервуар инфекции на своем участке.
  • Убедитесь, что картофель хорошо окучен, чтобы защитить клубни и предотвратить его распространение на них, даже если вы заразитесь листвой.
  • Поливать из основы, а не опрыскивать картофель. Если погода подходящая, но нет дождя, ваш искусственный дождь подавит болезнь. Негерметичные шланги — хороший способ поливать картофель, если у вас нет ограничений для шлангов
Как избежать фитофтороза

Поскольку фитофтороз картофеля имеет тенденцию поражать позже в течение сезона, когда погодные условия благоприятствуют этому, выращивание первого и второго раннего периода может помочь избежать грибка.Не каждый год, очевидно, но большую часть времени они вылезают из-под земли, когда наступает упадок сил.

Сорта картофеля устойчивые к фитофторозу

Некоторые виды картофеля сопротивляются болезням лучше, чем другие, хотя многое зависит от того, какой сорт они получают сейчас. Некоторые сорта лучше сопротивляются листве, а некоторые — клубням, поэтому урожай измеряется для обоих.

Относительно недавняя разработка и выпуск на рынок венгерских сортов картофеля Сарпо, которые чрезвычайно устойчивы к фитофторозу, стали благом для домашних производителей.Я держал Сарпо Мира здоровым, когда все остальные картофелины на делянке загорелись.

Лучший картофель для защиты от болезней листвы

Первая ранняя — Орла, Премьера

Вторая ранняя — Космос, Надин

Основная культура — Кара, Санте, Романо, Кондор, Сарпо Аксона, Сарпо Мира, Сарпо Гвин, Сарпо Шона, Сарпо Уна, леди Бальфур, Симфония, Верити, Пентленд Делл, Пентленд Сквайр

Лучший картофель для устойчивости к фитофторозу

Первый ранний — Орла, Коллин

Вторая ранняя — Космос, Никола

Main Crop — Кара, Санте, Рекорд, Кондор, Сарпо Аксона, Сарпо Мира, Сарпо Гвин, Сарпо Шона, Сарпо Уна, леди Бальфур, Доблесть, Пикассо

Примечание: Сарпо Мира имеет самый высокий рейтинг по фитофторозу клубней.

Товары для выращивания картофеля

См. Также:

.

Как защитить картофель от фитофтороза

Как защитить картофель от фитофтороза

Автор: В. Колобаев, доктор биологических наук

Источник: gazetasadovod.ru

 


Многим огородникам, выращивающим картофель, прошедшее лето запомнилось, как какое-то кошмарное бедствие.

Там, где картофель не погиб от затопления еще в середине июля, его ботву убила фитофтора уже в начале августа.

Август — период интенсивного клубнеабразования, создания основной массы урожая за счет продуктов фотосинтеза, производимых в листьях. Фитофтора, уничтожив эту фабрику фотосинтеза, сократила наполовину урожай клубней, который мог быть получен, не будь нашествия фитофторы. Фитофтора опасна не только снижением урожая. При копке клубни контактируют с зараженной ботвой, несущей конидии гриба, в результате происходит заражение клубней фитофторозом, провоцирующим загнивание их при хранении. Кроме того убитый фитофторой картофель не отсасывает воду т почвы, что усиливает ее переувлажнение, провоцирующее мокрую гниль клубней.

Таким образом, нашествие фитофторы влечет за собой сразу несколько несчастий. К тому же наиболее сильное поражение этой болезнью отмечается именно в годы, наиболее благоприятные для роста картофеля и клубнеобразования. Часто выпадающие дожди для самого картофеля полезны, способствуют накоплению урожая. Но те же самые погодные условия способствуют интенсивному развитию и широкому расселению фитофторы. В результате она «прибирает к рукам» всю ту выгоду от погодных условий, которую мог бы использовать картофель для увеличения урожая. Если помочь картофелю устоять от поражения фитофторозом, то часто выпадающие дожди из бедствия обращаются для него благом. В прошедшем сезоне количество и качество урожая во многом определялось успешностью борьбы с фитофторозом. Создав картофелю заслон от фитофторы, сохранив его с зеленой ботвой до конца сентября, можно полностью реализовать его потенциальную продуктивность и уберечь его клубни от загнивания. И все это не благие мечты, а вполне достижимая реальность.

На моем участке в окрестностях Павловска картофель до самой уборки в середине сентября почти не имел поражения фитофторой и выглядел как зеленый остров среди черно-бурого моря соседского картофеля, опаленного фитофторой. И это несмотря на то, что мой картофель находился в постоянном окружении источников инфекции. Превратить свой огород в неприступный бастион нашествию фитофторы я смог благодаря выращиванию устойчивых сортов и опрыскиванию фунгицидами (препаратами для борьбы с грибными болезнями).

Сущность химической защиты состоит в предупреждении заражения ботвы возбудителем фитофтороза. Конидии фитофторы не могут прорастать и внедряться в опрысканный фунгицидами лист. Они обеспечивают надежную защиту против фитофторы, когда опрыскивание проводится по еще здоровой ботве, накануне возможного заражения ее фитофторой.

Сигналом для ее немедленного проведения может служить появление первых очагов поражения на соседних огородах. Для защиты своего картофеля я провел 2 предупредительных опрыскивания: 20 июля, сразу же после обнаружения фитофторы на соседнем огороде, на сильновосприимчивом сорте Синеглазка, обычно поражаемом фитофторой в первую очередь, затем, 4 августа, т.е. через 15 дней.

Использовал раствор препарата Гальбен М 8-65, концентрации 0,6%. Это фунгицид системного действия, защищающий от заражения не только опрысканные листья, но и молодые вырастающие листья. Защитный эффект препарата продолжается в течение 12-14 дней после оп-рыскивания.

Для его проведения нужно выбрать день без дождя, чтобы препарат попал на сухую ботву. Препарат быстро впитывается в листья, так что если через 4 часа после обработки и пойдет дождь, он не ослабит действие химической защиты против фитофторы. В этом достоинство системных фунгицидов в отличие от медного купороса, легко смываемого дождем и способного защитить картофель не более, чем на 5 дней.

Основная площадь моего участка была засажена устойчивыми к фитофторе сортами — Елизавета, Чародей и Петербургский. Кроме того, высадил по 1 рядку 4 других сорта, в разной степени восприимчивых к болезни. Елизавета и Чародей вообще не имели никаких следов поражения фитофторой вплоть до середины сентября.

Природная устойчивость этих сортов в сочетании с химической защитой обеспечили им абсолютный заслон против фитофторы. У сорта Петербургский 15 августа появились единичные пятна поражения у растений на краю участка, подвергавшихся наиболее интенсивному заносу инфекции с соседних огородов.

А восприимчивые голландские сорта — Романо, Фреско и Сайте — даже двукратное опрыскивание системным фунгицидом не смогло полностью уберечь от поражения фитофторозом. Срок действия препарата на этих сортах оказался не более 10 дней. Поразились, но слабее 2 наших сорта — Никольский и Пушкинец.

Картофель, избавленный от поражения фитофторой, получивший хорошее удобрение и уход в начале вегетации, смог плодотворно использовать часто выпадавшие дожди для накопления высокого урожая, заметно контрастировавшего с полученным на соседних участках, сильно поразившихся фитофторой.

Наиболее урожайным оказался сорт Елизавета, посаженный 24 мая. При копке с 3-х кустов получал по ведерку клубней (7 кг). В урожае преобладали клубни крупного размера, загнивших клубней не было.

Несколько уступал в урожае сорт Петербургский того же срока посадки — он давал ведерко с 4-х кустов.

А сорта Чародей и Никольский — ведро с 5-ти кустов. Голландский сорт Сайте, имевший частично пораженную фитофторой ботву, уступил им в урожае — ведро от 6-ти кустов.

Сорт Фреско, хотя и поразился сильно фитофторой, но благодаря своей скороспелости смог к концу июля дать удовлетворительный урожай.

Надо сказать, что сорта Елизавета и Чародей, выращенные вблизи города Пушкина без химической защиты, имели к концу августа слабое поражение фитофторозом. Опрыскивание же системным фунгицидом обеспечило им полную защиту от болезни.

И это несмотря на погодные условия, исключительно благоприятные для развития фитофторы. Что же касается сортов, не имеющих устойчивости к болезни, то получение у них хорошего урожая обеспечивалось лишь при опрыскивании фунгицидами.

Без химической защиты ботва у них уже в начале августа оказалась убитой фитофторозом, урожай был ничтожным, к тому же многие клубни имели заражение фитофторой.

Чтобы иметь гарантию получения высокого урожая, независимо от того как сложатся погодные условия в будущем году, высаживайте устойчивые к фитофторе сорта, а во второй половине июля готовьтесь проводить опрыскивание фунгицидами.

Надежную защиту дают системные фунгициды — Гальбен, Арцерид, Ридомил МЦ, в концентрации 0,6%, а также полусистемный Акробат и Поликарбацил — местного действия.

Лучше перестраховаться, чем взирать потом на пепелище, вызванное фитофторой на вашем огороде. Тем более, что поражение фитофторозом в будущем году вполне возможно, учитывая массовое заражение возбудителями болезни клубней урожая нынешнего года. Они будут служить исходными источниками инфекции.

 

 

 





  







 


  

 





Смотрите также:






Предложено новое средство защиты картофеля от фитофторы — Российская газета

Ученые ТюмГУ в составе научного коллектива исследовали, как пептидные экстракты лекарственных растений влияют на паразитарные организмы, поражающие картофель. Перспективным для борьбы с паразитами признан экстракт хвоща обыкновенного. Результаты работы опубликованы в журнале Plants.

Как сообщают авторы публикации, заболевания растений, вызываемые мицелиальными организмами (оомицетами), являются серьезной проблемой для сельского хозяйства во всем мире. Одно из таких заболеваний — фитофтороз — поражает картофель и томаты. Возбудитель заболевания оомицет фитофтора (Phytophthora infestans) вызывает у картофеля некроз листьев, разложение клубней и гибель растения.

— Распространенным способом борьбы против фитофтороза является обработка картофеля пестицидами. Однако патогенные микроорганизмы становятся все более устойчивыми к химическим препаратам. Поэтому ученые ищут альтернативные способы защиты растений, — рассказал один из авторов исследования, заведующий «молодежной» научной лабораторией антимикробной резистентности кандидат биологических наук Алексей Васильченко.

По словам ученого, натуральные экстракты, полученные из растений, применяемых в медицине, являются перспективным дополнением химическим пестицидам. Их применение позволит уменьшить количество остатков пестицидов в продуктах питания и окружающей среде. Кроме того, можно снизить стоимость комплексной защиты растений.

Коллектив исследователей из Института биоорганической химии имени М.М. Шемякина и Ю.А. Овчинникова РАН, НИИ по изысканию новых антибиотиков имени Г.Ф. Гаузе, Всероссийского института защиты растений, Института экологической и сельскохозяйственной биологии (X-BIO) ТюмГУ и Российского государственного аграрного университета (МСХА имени К.А. Тимирязева) изучил влияние на фитофтору семи лекарственных растений.

Для эксперимента были отобраны чистотел большой (Chelidonium majus), девясил высокий (Inula helertium), хвощ обыкновенный (Equisetum arvense), лавр благородный (Laurus nobilis), зеленый чай (Camellia sinensis), зверобой продырявленный (Hypericum perforatum).

Картофельные клубни нарезали на диски и обрабатывали экстрактами этих растений. Затем ученые наблюдали прорастание фитофторы в лабораторных условиях с использованием оптической микроскопии. По словам исследователей, результаты указывают на способность пептидных экстрактов подавлять появление симптомов фитофторы (некротических пятен и споровидных слоев) в течение 144 часов после обработки картофельного диска.

Наиболее выраженный эффект показал пептидный экстракт из хвоща обыкновенного. Таким образом, по утверждению авторов статьи, был отобран кандидат на роль активного вещества для разработки нового биопестицида.

Исследование было поддержано Российским научным фондом (грант № 19-76-30005) и Российским фондом фундаментальных исследований (грант № 18-34-20058). Исследования выполняются по тематике «Биобезопасность человека, животных и растений» Западно-Сибирского межрегионального НОЦ.

Сайт ТюмГУ.

Материал предоставлен управлением стратегических коммуникаций ТюмГУ

Как спасти помидоры от фитофторы

 

 

Фитофтороз часто поражает помидоры, поэтому садоводам важно знать, как защитить свой урожай томатов. Фитофтора (или фитофтороз) – самое распространенное грибковое заболевание томатов и других пасленовых (картофеля, баклажанов), которое проявляет себя чаще всего в пасмурную сырую и прохладную погоду. Как защитить помидоры от фитофторы, как спасти заболевшие кусты, какие препараты использовать, какие народные средства помогут от болезни, как не допустить появления фитофторы в теплицах и на грядках? Вопросов масса! Попробуем разобраться с этой грозной фитофторой и победить ее.

 

 

Признаки поражения фитофторой

 

Фитофтороз – это грибковое заболевание, споры этого гриба зимуют в земле, в основном же распространяются в картофельных клубнях, в которых они благополучно переживают зиму, а с весенними посадками просыпаются. Потому первый фитофторой поражается картофель, а потом споры перелетают на помидоры. Начинается фитофтора появлением на листьях темных бурых пятен, потом они переходят на стебли и плоды. Сначала поражаются нижние листья. Пятна могут быть разной формы и размера. На листьях вначале заболевания бывает белёсый налёт. Плоды заболевают через плодоножку. Сначала они могут оставаться чистыми, но в процессе хранения на них тоже появляются коричневые пятна. Это заболевание может уничтожить все посадки помидоров за несколько дней.

 

Условия для развития фитофторы

 

✿ Чаще всего на томатах фитофтора появляется в августе, после холодных ночей и туманных сырых утренников. Но заболеть томаты могут и раньше – в июле. Благоприятная погода для развития болезни – температура ниже +15°С и высокая влажность.

✿ Загущённые посадки способствуют появлению фитофторы. Поэтому лишние листья нужно обрывать, чтобы улучшить проветривание кустов.

✿ Полив помидоров по листьям тоже помогает им заболеть. Поэтому в открытом грунте фитофтора часто появляется после дождливой холодной погоды.

✿ Низкие температуры – это тоже повод для профилактики помидоров от фитофторы.

 

Профилактика фитофтороза томатов

 

Помидоры любят сухую погоду. Сильная влажность в тёплую погоду, а ещё быстрее в прохладную приводит к заболеванию. Начинается оно с нижних листьев, где скапливается больше влаги. Нужно постоянно проверять нижние листья и если начинается их потемнение – сразу удалять. Нижние листья убирают до первой поспевающей кисти постоянно. Также обрывают желтеющие и подсыхающие листья. Важно создать хорошее проветривание посадок помидоров.

Можно накрывать сверху ряды томатов плёнкой или укрывным материалом, чтобы она свисала по бокам, не задевая земли. Так сохранится проветривание, и помидоры будут укрыты от ночных холодных рос.

Профилактикой фитофторы можно назвать полное мульчирование земли под посадкой помидоров.

Фитофтороз сначала поражает посадки картофеля, поэтому не следует сажать рядом с ним томаты. Так же близкий родственник помидоров и картофеля — баклажан, тоже может болеть фитофторой и лучше его рядом не садить.

На маленьких участках защиту можно создать из кулисных растений, посеянных по периметру грядок. Например: горох, вьющаяся фасоль, кукуруза.

Хорошей профилактикой будет опрыскивание посадок и земли биопрепаратами фитоспорин и триходермин ещё до появления заболевания. Они подавляют распространение болезней.

Нужно укреплять растения с молодого возраста. Закалять. Достаточно удобрять и подкармливать (без фанатизма и излишеств, конечно). Поливать настоем золы во время созревания плодов. Чтобы они были сильными и крепкими, тогда им легче будет бороться с болезнями. А вот азотными удобрениями (коровяк, травяные настои) во второй половине лета подкармливать не стоит – это ослабляет растения, они быстрее заболеют.

 

Как уберечь помидоры

от фитофторы в теплице

 

В теплице помидоры хорошо защищены от фитофторы. Даже если на улице холодно и сыро, у них много преимуществ. В теплице создается свой климат, который можно регулировать. Не забывать проветривать, а также про профилактику.

✿ Не загущать посадки.
✿ Обрывать пасынки и лишние листья.
✿ Подвязывать кусты.
✿ Мульчировать землю.

Также для защиты томатов в теплице не сажайте рядом картофель и помидоры открытого грунта, чтобы споры с них не попали в теплицу.

В конце июня нужно опрыскать помидоры в теплице биопрепаратом фитоспорин для профилактики. Постоянно обрабатывать им землю под томатами.

 

Как спасти помидоры

от фитофторы в открытом грунте

 

Медь – хорошо помогает от фитофторы. Препараты с медью используются для борьбы и профилактики заболевания. Используются препараты Хом, Полихом, Оксихом, их можно разводить прямо в холодной воде в лейке (по инструкции).

Можно сделать раствор самим. Добавить брусок хозяйственного мыла для прилипания и пакетик медного купороса на ведро воды. Также можно обработать кусты настоем древесной золы.

Если все народные средства перепробованы и не помогают, тогда приходится использовать химию. Средств разных много в садовых магазинах. Самые рабочие – это фунгициды. Споры болезни тоже приспосабливаются к разным химикатам, поэтому их придётся чередовать, чтобы был разный состав. Использовать их нужно осторожно. Только до начала созревания плодов. Если уже помидоры начинают наливаться, то химию нельзя применять. Отравите свой урожай.

Химические средства защиты тоже не панацея. Использовать их нужно начинать с рассадного возраста и повторять обработки несколько раз. Особенно если лето дождливое и холодное.

Лечение фитофторы

на помидорах в теплице

 

Препаратами с медью пользоваться не стоит – ведь в теплице постоянно есть поспевающий урожай. Лучше использовать народные методы. Те же настои чеснока, лука или молочный раствор. Они описаны в народных рецептах дальше в статье.

Можно опрыскать помидоры просто водой с йодом. На ведро воды берут 10 мл обычного 5% йода. Перед применением нужно удалить все пожелтевшие и больные листья с тёмными пятнами. Опрыскивают полностью кусты и плоды. Через 3 дня повторяют процедуру.

 

Народные способы

борьбы с фитофторой на помидорах

 

Народные методы борьбы с фитофторой на томатах лучше использовать для профилактики заболевания. Если фитофтору уже явно видно на кустах, то эффективней использовать химию для борьбы с заболеванием.

 

Чесночный настой

 

Для приготовления чесночного настоя берут 200 грамм чеснока (можно заменить луком) и настаивают в ведре воды сутки. После процеживания, опрыскивают заболевшие растения и помидорки. Опрыскивание повторять каждые 2 недели.

 

Молочный раствор или сыворотка

 

Молоко разводиться в воде (100грамм на литр) и опрыскивают помидоры. Можно заменить молоко кефиром. Молочнокислые бактерии не дают развиваться фитофторе. Можно в молочную воду добавить несколько капель йода. Такое опрыскивание не только защитит от фитофторы, но и послужит удобрением вашим помидорам. Лучше повторять опрыскивание каждые 2 недели.

Можно опрыскивать помидоры раствором сыворотки (разбавляется водой 1 к 1) – эффект такой же, как от молочного раствора. Этот раствор хорошо использовать для профилактики всё лето. Не дожидаясь появления болезни.

 

Раствор соли

 

Часто опрыскивают помидорные кусты раствором простой поваренной соли (один стакан на ведро воды). Этот раствор защищает томаты от различных заболеваний, после высыхания он образует плёнку на плодах. После дождей необходимо повторять опрыскивание.

Генетические аспекты
устойчивости картофеля к фитофторозу

Abstract

Оомицет Рhytophthora infestans Mont. de Bary – основной патоген сельскохозяйственных культур
семейства Пасленовые, особенно картофеля (Solanum tuberosum). С учетом того, что картофель – четвертая культура в мире по масштабам выращивания, ежегодные потери от фитофтороза огромны. Исследования базовых
механизмов взаимодействия между картофелем и возбудителем фитофтороза не только расширяют фундаментальные знания в этой области, но и открывают новые возможности для влияния на эти взаимодействия с целью
повышения резистентности к патогену. Взаимодействие картофеля и возбудителя фитофтороза можно рассматривать с генетической точки зрения, причем интересны как ответ картофеля на процесс колонизации со стороны P. infestans, так и изменение активности генов у фитофторы при заражении растения. Можно исследовать
этот процесс через изменение профиля вторичных метаболитов хозяина и патогена. Помимо фундаментальных
исследований в этой области, не меньшее значение имеют и прикладные работы в виде создания новых препаратов для защиты картофеля. Представленный обзор кратко описывает основные этапы исследований устойчивости картофеля к фитофторозу, начиная с самых первых работ. Большое внимание уделяется ключевым
моментам по изменению профиля вторичных метаболитов (фитоалексинов). Отдельный раздел посвящен описанию как качественных, так количественных признаков устойчивости картофеля к возбудителю фитофтороза:
их вкладу в общую резистентность, картированию и возможности регуляции. Оба вида признаков важны для
селекции картофеля: качественная устойчивость за счет R-генов быстро преодолевается патогеном, в то время
как пирамидирование локусов количественных признаков способствует созданию высокоустойчивых сортов.
Новейшие подходы молекулярной биологии дают возможность изучать и транслятомные профили, что позволяет посмотреть на взаимодействие картофеля и возбудителя фитофтороза. Показано, что процесс колонизации
картофеля отражается не только на активности различных генов и профиле вторичных метаболитов, выявлены
также белки-маркеры ответа на заражение со стороны картофеля – это патоген-зависимые белки и пластидная
углекислая ангидраза. Маркерами заражения от P. infestans были белки грибной целлюлозо-синтазы и гаусторий-специфический мембранный белок. В данном обзоре приведена информация по наиболее актуальным комплексным исследованиям генетических механизмов устойчивости картофеля к фитофторозу.

Keywords: Phytophthora infestans, Solanum tuberosum, фитофтороз, резистентность, R-гены, локусы количественных признаков, вторичные метаболиты

Abstract

Phytophthora infestans Mont. de Bary is the main oomycete pathogen of cultivated crops in the family Solanaceae, especially potato (Solanum tuberosum). Because potato is the fourth most cultivated crop worldwide, its annual
losses from late blight are tremendous. Studies of the basic mechanisms of interaction between potato and the late
blight pathogen not only expand the fundamental knowledge in this area, but also open up new possibilities for regulating these interactions in order to increase resistance to the pathogen. The interaction of potato and the late blight
pathogen can be considered from a genetic point of view, and it is interesting to consider both the response of the potato to the colonization process by P. infestans and the change in gene activity in late blight during plant infection. We
can also investigate this process by changing the profile of secondary metabolites of the host and the pathogen. In addition to fundamental work in this area, applied work in the form of the development of new preparations for protecting potatoes is of no less importance. This review briefly describes the main stages of studies of potato resistance to late
blight, starting almost from the first works. Much attention is paid to key works on changing the profile of secondary
metabolites phytoalexins. A separate section is devoted to the description of both qualitative and quantitative characteristics of potato resistance to the late blight pathogen: their contribution to overall resistance, gene mapping, and regulation capabilities. Both types of traits are important for potato breeding: quantitative resistance due to R-genes is
quickly overcome by the pathogen, while quantitative trait loci make it possible to create varieties with almost absolute
resistance due to the pyramid of effective genes. The latest approaches in molecular biology make it possible to study
translatomic profiles, which makes it possible to look at the interaction of potatoes and the late blight pathogen at a
different angle. It has been shown that the process of potato colonization affects not only the activity of various genes
and the profile of secondary metabolites: proteins-markers of the response to infection from potatoes have also been
identified: they are pathogen-bound proteins and plastid carbonic anhydrase. On the part of P. infestans, fungal cellulose synthase proteins and haustorium-specific membrane protein were markers of infection. Thus, the review contains
information on the most relevant complex studies of the genetic mechanisms of potato resistance to late blight.

Keywords: Phytophthora infestans, Solanum tuberosum, late blight, resistance, R-genes, quantitative trait loci, secondary metabolites

Введение

Картофель, или паслен клубненосный (Solanum tuberosum L.), был одомашнен около 7000–10 000 лет назад на
территории современного Южного Перу. В Европу картофель был завезен испанцами относительно недавно,
во второй половине XVI в. С тех пор он стал одной из
основных сельскохозяйственных культур, занимая по масштабам выращивания четвертое место после кукурузы,
пшеницы и ржи. В связи с большими объемами возделывания весьма существенными являются потери урожая
из-за различных патогенов, основной из которых – возбудитель фитофтороза (Phytophthora infestans), способного
полностью уничтожить растения спустя несколько дней
после появления первых симптомов заражения. Поэтому
изучение механизмов взаимодействия картофеля и возбудителя фитофтороза на молекулярном и генетическом
уровнях очень важны для создания новых подходов для
повышения резистентности картофеля.

Первые труды, посвященные взаимодействию S. tuberosum и P. infestans, относятся к концу 1960-х гг. (Ingram,
Robertson, 1965; Ingram, 1967; Robertson et al., 1968). В работах проводили сравнение восприимчивого (Majestic) и
устойчивого (Orion) к возбудителю фитофтороза сортов
картофеля. Ранее было показано, что гены устойчивости
(R-гены) экспрессируются только во фрагментах ткани
толщиной более 10 клеток (Tomiyama et al., 1958), поэтому
исследование осуществляли на клеточных культурах и
тканевых агрегатах. Было сделано два ключевых вывода:
1) в тканях обоих сортов содержатся вещества, стимулирующие рост возбудителя фитофтороза, т. е. они являются
нормальными метаболитами живых тканей, а не образуются в ответ на заражение; 2) тканевые агрегаты сорта
Orion тормозили развитие возбудителя фитофтороза, но
после заморозки и, как следствие, разрушения тканей это
свойство пропадало. Таким образом, был сделан вывод,
что резистентность – это свойство живых тканей, способных реагировать на патоген (Ingram, Robertson, 1965).
В дальнейшем было установлено, что картофель сорта
Orion может быстро развивать постинфекционную токсичность, тормозящую рост зародышевых трубок P. infestans,
тем самым предотвращая инфицирование. Ключевая роль
в развитии этого ответа отводится R-гену (Ingram, 1967).

Соединения, обуславливающие устойчивость растений
к патогенам, ранее были названы фитоалексинами (Müller,
Behr, 1949). В предыдущих исследованиях высказывалось предположение, что именно они нарабатываются в тканях
в ответ на инфицирование, что и приводит к ингибированию патогенов. Позднее была опубликована статья,
свидетельствующая о накоплении фенольных соединений
в токсичных для фитофторы фракциях (Robertson et al.,
1968): салициловой, п-гидроксибензойной и ванилиновой
кислот. Авторы высказывают предположение, что система
устойчивости, основанная на R-гене, может быть связана
с постинфекционной индукцией синтеза фитоалексинов.
Примерно в это же время были описаны фитоалексины
сесквитерпеноидной структуры: ришитин, любимин, фитуберин и солаветивон, выделенные из зараженных клубней картофеля (Katsui et al. , 1968; Kuć, 1982; Kuć, Rush,
1985).

Спустя почти 20 лет было издано подробное исследование временного накопления ришитина как наиболее
показательного маркера иммунного ответа в клубнях резистентных и восприимчивых сортов в ответ на заражение
P. infestans (Rohwer et al., 1987). Обнаружено, что ришитин
и некоторые его структурно родственные производные
(любимин) быстро накапливались в клубнях при несовместимых взаимодействиях картофеля и фитофторы и достаточно медленно – у совместимых, в листьях подобный
ответ отсутствовал. Сделан вывод, что сесквитерпены
могут быть полезны в развитии иммунного ответа, но не
являются обязательными компонентами устойчивости.

Интересная работа была проведена по приданию
устойчивости картофеля к P. infestans через создание соматических и половых гибридов культивируемого S. tuberosum с диким подвидом S. circaeifolium Bitter, устойчивость которого к возбудителю фитофтороза – весьма
привлекательный признак для включения в генофонд
культурного картофеля. Путем слияния клеток были получены тетраплоидные гибридные каллусы (Mattheij et al.,
1992), а растения из них обладали полной устойчивостью
к P. infestans. Исследователи сравнили содержание гликоалкалоидов у родительских растений и гибридов и обнаружили повышенное содержание томатидин гликозида,
позаимствованное гибридом от дикого S. circaeifolium.
Кроме того, был обнаружен новый гликозид демиссидин, не найденный ни у одного из родителей. Отмечаются
фертильность полученных женских растений и возможность их скрещивания с культивируемым S. tuberosum
для закрепления приобретенной устойчивости. Этой же
группой исследователей были созданы половые гибриды S. tuberosum и S. circaeifolium (Louwes et al., 1992). Среди
гибридов наблюдались преимущественно триплоидные
растения (83 %), несущие двойной геном S. circaeifolium,
что делает их более устойчивыми к патогену и, как
следствие, более перспективными для использования в
селекции. Половые гибриды также обладали повышенным содержанием томатидин гликозида и демиссидин
гликозидом, не обнаруженным у родительских растений.

Картирование признаков устойчивости
в геноме S. tuberosum

Качественные признаки, обусловленные R-генами

В начале XXI в. развитие компьютерных технологий и
статистических методов дало возможность проводить
более масштабный анализ групп сцепления, выявлять
локусы с генами количественных признаков и строить
для них карты сцепления. Были созданы карты сцепления
для диплоидного картофеля, согласно которым локусы
качественной устойчивости к возбудителю фитофтороза
располагаются практически в каждой хромосоме, а на
хромосомах III, IV, V и VI были сцеплены с поздней спелостью (Gebhardt, Valkonen, 2001; Simko, 2002). Позднее
подобные результаты были получены и для тетраплоидного картофеля (Bradshaw et al., 2004) при скрещивании
устойчивого (Stirling) и восприимчивого сортов. Среди
множества групп сцепления обнаружен перспективный
локус в хромосоме IV, который не сцеплен с поздней
спелостью клубней. У устойчивого родительского растения R-ген, переданный потомству, был картирован в
хромосоме XI.

Несмотря на обилие работ, посвященных картированию R-генов в геноме картофеля (Ballvora et al., 2002;
Van Der Vossen et al., 2003; Park et al., 2005; Restrepo et al.,
2005; Bradshaw et al., 2006a, b; Solomon-Blackburn et al.,
2007; Brugmans et al., 2008; Tan et al., 2008; Rauscher et al.,
2010), следует отметить, что устойчивость к возбудителю
фитофтороза сортов картофеля на основании R-генов сохраняется на протяжении 5–10 лет, после чего сорт становится восприимчивым к новым расам P. infestans (Stewart et al., 2003). Распознавание патогена R-геном довольно быстро нивелируется мутациями в соответствующем
гене авирулентности P. infestans, что позволяет патогену
успешно проникать и колонизировать растение-хозяина
при совместимом взаимодействии (Poland et al., 2009).

Биоинформатические методы были использованы и для
изучения механизмов восприимчивости. Показано, что
карбоангидраза – фермент, обратимо конвертирующий
диоксид углерода в бикарбонат, может играть большую
роль во время несовместимых взаимодействий между
патогеном и хозяином (Restrepo et al. , 2005). С помощью
ДНК-микрочипов было исследовано временное изменение экспрессии R-генов: в первые часы после заражения
(6–12 ч) в целом наблюдалась индукция экспрессии, но
спустя некоторое время (48–72 ч) большая часть генов
подверглась репрессии. Интересным выглядит подавление
жасмонатного пути при восприимчивых взаимодействиях.
Однако при заражении в основном подавляются гены,
связанные с фотосинтезом: так, наиболее выраженное
подавление обнаружено для пластидной карбоангидразы, которая обладает антиоксидантной активностью и способностью связывать салициловую кислоту (Slaymaker
et al., 2002). В первые 12 ч наблюдалось существенное
усиление экспрессии карбоангидразы при несовместимых
взаимодействиях, тогда как через 24 или 48 ч ее следы
едва обнаруживались, что позволяло однозначно отличить устойчивые формы. Значительная роль салициловой
кислоты именно в раннем ответе S. tuberosum на инфицирование была продемонстрирована с помощью трансгенных NahG растений, которые не способны накапливать
салициловую кислоту, их восприимчивость к P. infestans
была гораздо выше, чем у дикой формы. Однако предварительная обработка растений препаратом салициловой
кислоты практически уравнивала вероятность заражения
(Halim et al., 2007).

Помимо единичных доминантных R-генов устойчивости, отвечающих за распознавание соответствующего гена
авирулентности P. infestans и запускающих защитный ответ, проявляющийся в локальной гибели клеток (реакция
сверхчувствительности) и тем самым останавливающий
рост патогенных микроорганизмов, у растений существует
группа генов с другим механизмом защиты – гены множественной устойчивости. Исследована экспрессия четырех
генов-транспортеров у картофеля, транскрипция которых
регулировалась различными препаратами (Ruocco et al.,
2011). Среди них были выявлены и те, экспрессия которых
существенно возрастает при заражении P. infestans, – гены
StPDR1 и StPDR2 экспрессировались активнее в 13 и 37
раз соответственно спустя 18 ч после заражения. Авторы
полагают, что все исследованные ими гены (StPDR1–4)
являются частью более сложного системного ответа растения на биотические и абиотические факторы.

Локусы количественных признаков у S. tuberosum

Масштабная попытка картирования локусов количественных признаков у картофеля была предпринята в 2018 г.
(Santa et al., 2018). Исследователи снова выбрали в качестве объекта тетраплоидный геном картофеля, отмечая его
высокую важность для селекции и при этом существенные
затруднения в силу высокой гетерозиготности у автотетраплоидного картофеля. Ученым удалось обнаружить
два новых QTL на хромосомах III и VIII. Отмечается,
что один из аллелей первого локуса может опосредовать
в среднем более высокую степень тяжести заболевания.
Этот локус также включает транскрипционный фактор
Arf 2, связанный со старением листьев, вызванный окислительным стрессом у Arabidopsis и передачей сигналов
гиббереллина и брассиностероидных путей при взаимодействии растения с патогеном (Vert et al., 2008; Lim et al.,
2010; Koch et al., 2016). Аллель, определяющий в среднем
более низкую степень тяжести заболевания, содержал QTL
хромосомы VIII. Этот маркер связан с геном, который
кодирует фактор транскрипции спираль-петля-спираль
(bHLH) JAF13, участвующий в биосинтезе флавоноидов
у Petunia×hybrida (Quattrocchio et al., 2006).

Были получены трансгенные растения со сверхэкспрессией гена редуктазы D-галактуроновой кислоты и
повышенным уровнем L-аскорбата (Chung et al., 2019).
После заражения размер некротических пятен у трансгенных растений был меньше, чем в контрольной группе, при этом обнаружено увеличение экспрессии генов,
участвующих в антиоксидантной активности. В результате выявлено снижение активных форм кислорода (АФК)
в клетках, что может объяснять меньший размер некротического пятна за счет уменьшения ответа реакции
сверхчувствительности, индуцируемого АФК. В целом
отмечалась большая устойчивость трансгенных растений
к возбудителю фитофтороза, однако полной устойчивости
не наблюдалось. L-аскорбат снизил содержание абсцизовой кислоты и увеличил содержание гибберелиновой
кислоты. Но при этом установлена существенная потеря
в урожайности картофеля, которая все же превышала
урожай от зараженного.

Транскриптомный анализ
для совместимых и несовместимых
взаимодействий P. infestans и S. tuberosum

В 2012 г. впервые выполнен транскриптомный анализ для
совместимых и несовместимых взаимодействий P. infestans и S. tuberosum (Gyetvai et al., 2012). Исследовано пять
изогенных линий, которые различались только наличием
и отсутствием R-гена (R1), с целью исключить влияние
генетического фона на транскриптом. Однако оказалось,
что изменения транскриптома между растениями одной
линии отличаются больше, чем средние транскриптомы
линий между собой, что указывает на значительное влияние как индивидуальных физиологических параметров,
так и факторов окружающей среды в процессе защитной
реакции. Одним из них может быть движение во времени
и пространстве защитных сигналов от места первоначального физического контакта между зооспорами P. infestans
и клетками-хозяевами и соседними клетками. Анализ
DeepSAGE позволил выявить некоторые интересные аспекты общей структуры транскриптома. Две трети (68 %)
унитагов были экспрессированы на низких уровнях
(<10 CPM) в ткани листьев, из которых одна треть (36 %)
не соответствовала ни одному из известных транскриптов
картофеля, что может быть объяснено немодельным объектом и немногочисленными данными о транскриптоме
S. tuberosum. С другой стороны, только 3 % унитагов показали среднюю экспрессию выше 100 CPM, но составили
32 % от общего транскриптома. Из очень частых транскриптов только 14 % были не известны. Нужно отметить
следующие транскрипты из этого исследования:

  1. Наиболее частый тег (StET008016) соответствует унигену TC208859, аннотированному как белок клеточной
    стенки – экспрессия этого гена составляла 4 % всех
    транскриптов в тканях листьев. Белки этого семейства
    выполняют функцию каркаса в качестве агглютинирующих агентов для отложения компонентов клеточной
    стенки (Mangeon et al., 2010). Обнаружено также их
    участие в защитной реакции растений против бактерий
    и грибов (Park et al., 2000; Fu et al., 2007).

  2. Через один день после инокуляции транскрипт
    StET009643, соответствующий гену трансальдолазы
    ToTAL2 (TC196885), специфически и временно повышался во время несовместимых взаимодействий.
    Трансальдолазы (ЕС 2.2.1.2) катализируют образование одного из предшественников шикимовой кислоты,
    который участвует в образовании фенилпропаноидов, алкалоидов и растительных гормонов ауксина и салициловой кислоты – важного компонента системы защиты растения

  3. Через три дня после инфицирования транскрипт
    StET010841, соответствующий гену фибриллина 8
    (TC207935), был строго и специфически репрессирован. Растительные фибриллины представляют собой
    структурные липид-ассоциированные белки, расположенные в тилакоидных мембранах, которые, по-видимому, играют роль в реакциях биотического и абиотического стресса, роста и развития и в гормональной
    сигнализации.

  4. Снижается уровень транскриптов карбоангидразы, что
    может быть использовано для повышения устойчивости к P. infestans (унигены TC209461, TC218724 или
    TC221870 аннотированы как карбоангидразы).

В работе показано, что изменения транскрипции во время инфекции в совместимых взаимодействиях были более
выраженными, чем в несовместимых. Число последовательностей-мишеней, однако, было одинаковым: 240 и 220
для несовместимых и совместимых взаимодействий соответственно. В целом транскриптомы несовместимых и
совместимых взаимодействий показали больше различий,
чем общности. Несовместимое взаимодействие приводит
к запрограммированной гибели небольшого числа клеток
в месте первичного контакта с патогеном. Транскриптом
этих клеток может претерпеть значительные изменения,
тогда как отобранные соседние ткани остаются относительно нетронутыми. Наблюдаемые изменения могут
быть причинами или следствиями сигналов системной
приобретенной резистентности.

Таким образом, через некоторое время интерес к R-генам как перспективным для селекции кандидатам существенно уменьшился, устойчивость за счет них достаточно быстро сводилась к нулю новыми расами возбудителя фитофтороза. Вместо поиска основного гена
исследователи перешли к мнению, что резистентность
более перспективно рассматривать как полигенный и, как
следствие, количественный признак. Поэтому вектор исследований изменился на поиск новых генов-кандидатов
и их картирования для эффективного сочетания аллелей
повышенной резистентности в улучшенных сортах. Постулируется, что для преодоления полигенной устойчивости картофеля требуется большее число мутаций в генах
авирулентности возбудителя.

При использовании SNP-маркеров были выявлены
следующие гены: гены липоксигеназы (жасмонатный
путь), 3-гидрокси-3-метил-глутарил-коэнзим А редуктаза
(мевалонатный путь) и цитохром р450 (терпеновый биосинтез) (Mosquera et al. , 2016).

С учетом предыдущих исследований (Pajerowska-Mukhtar et al., 2009; Odeny et al., 2010; Muktar et al., 2015)
суммарно выявлено 10 наиболее подходящих локусов
для применения в качестве диагностических маркеров в
селекционных программах. Эти гены кодируют ферменты, функционирующие в жасмонатном и оксилипиновом
путях (StAOS2, Plox1), в биосинтезе липидов (BCCP, биотинкарбоксильный белок-носитель) и вторичных терпеновых метаболитов (HMGCR, CYP71D11). Есть гены с
неизвестной функцией (StGP28) или функцией распознавания патогенов (Rpi-vnt1) и транскрипционной регуляции (TEF1, C3HL-TF, RBP50). Их важность как генов-кандидатов для придания устойчивости в селекции важна для
(1) непосредственного участия в контроле количественной
устойчивости к возбудителю фитофтороза, которая не изменяется при поздней зрелости растений, (2) дальнейшей
функциональной характеристики и (3) подтверждения
диагностической способности в различных селекционных
популяциях и средах

Изопрен синтезируется в растениях двумя путями: аце-тат/мевалонатным и дезоксиксилозафосфат/метилэритритфосфатным. Ген-участник резистентности 1-дезоксиD-ксилулозо-5-фосфат синтазы 1 (StDXS1) был обнаружен
во втором пути (Henriquez et al., 2016). Его экспрессия
изменяется в ответ на заражение и коррелирует с накоплением 1-дезокси-D-ксилулоза-5-фосфат синтазы – фермента, катализирующего начальную стадию 2-C-метил-Dэритрит-4-фосфатного пути (DOXP-MEP), участвующего
в биосинтезе изопреноидов, необходимых для мембран
хлоропластов. Изопреноиды также нужны для синтеза каротиноидов и хлорофилла, абсцизовой и гибберелиновой
кислот, содержание которых, соответственно, увеличивается при увеличении экспрессии StDXS1.

Еще одна временная динамика при заражении была
получена для гена StPOTHR1 с использованием трансгенных растений, где целевой ген был выключен за счет
РНК интерференции (Chen et al., 2018). Белковый продукт
гена StPOTHR1 локализуется на плазматической мембране
клеток и существенно уменьшает степень колонизации,
причем его сверхэкспрессия усиливает резистентность,
экспрессироваться этот ген начинает после заражения в
устойчивых сортах.

Исследование посттрансляционных
модификаций (SUMO) в процессе заражения
картофеля возбудителем фитофтороза

Сумоилирование – один из типов посттрансляционной
модификации белков в клетке, реализуемой за счет небольшого (~100 аминокислотных остатков) белка SUMO
(small ubiquitin-related modifier), способного ковалентно
присоединяться к мишени, подобно убиквитинилированию, однако не приводящему к деградации субстрата.

Инвазивные растительные патогены развили возможность модифицировать метаболизм своего хозяина, стимулируя метаболические процессы, которые способствуют
росту патогена (Colignon et al., 2017). Действительно,
было обнаружено, что во время процесса заражения содержание большинства известных конъюгатов SUMO
S. tuberosum значительно изменяется, некоторые уменьшаются, но многие существенно увеличиваются. Выявлены
белки-маркеры ответа на заражение со стороны картофеля – это патоген-связанные белки (PR1) и вышеупомянутая пластидная карбоангидраза (CA). Маркерами от
P. infestans заражения были белки грибной целлюлозосинтазы (CesA3) (Grenville-Briggs et al., 2008) и гаусторий-специфический мембранный белок (PiHmp1) (Avrova
et al., 2008). Синтез белка PR1 стимулируется салициловой
кислотой, способность поддерживать его в высокой концентрации после заражения отличает резистентные растения (Eschen-Lippold et al., 2012). Роль CA все еще остается неясной, однако разница в уровне СА также позволяет
различить устойчивые и не устойчивые к возбудителю
фитофтороза сорта (Restrepo et al., 2005). Гены белковых
маркеров P. infestans сначала активно экспрессировались
как в устойчивых, так и в неустойчивых сортах, но при
несовместимом взаимодействии их активность начинала
снижаться через 24 ч после заражения. Таким образом,
получены доказательства, что в восприимчивых сортах
картофеля патогену удается ингибировать защитные механизмы растения и успешно инфицировать растения,
в то время как в устойчивых сортах такое явление не
наблюдалось.

Заключение

В настоящее время генетических исследований защитных
реакций со стороны картофеля существенно больше, чем
вирулентности со стороны P. infestans, и основная их
часть направлена на поиск и картирование локусов количественных признаков, отвечающих за резистентность.
На заре исследований наибольший интерес вызывали
R-гены, одного аллеля которых часто было достаточно
для устойчивости к возбудителю фитофтороза. Таким
образом, резистентность рассматривалась преимущественно как качественный признак. Позже выяснилось,
что созданные сорта невыгодны с экономической точки
зрения – P. infestans легко преодолевает моногенную
устойчивость за счет особенностей строения своего генома. Это обстоятельство заставило пересмотреть взгляды и
перейти к оценке резистентности как к признаку количественному, поэтому встал вопрос о поиске локусов количественных признаков, которые могут быть перспективны для селекции. В процессе исследования установлено,
что у культурного картофеля основные локусы, дающие
резистентность, часто сцеплены с негативными для продуктивности растений качествами, например с поздней
зрелостью клубней. Поэтому поиск новых локусов попрежнему остается актуальной задачей.

Несмотря на большой прогресс в понимании механизмов устойчивости и способности предсказывать вспышки
фитофтороза, пандемические вспышки с колоссальным
уроном все еще случаются в разных странах (Fry et al.,
2013; Chowdappa et al., 2015), что свидетельствует о недостаточности полученных знаний для эффективной защиты
сельскохозяйственных растений и необходимости новых
исследований в этом направлении.

Conflict of interest

The authors declare no conflict of interest.

References

Avrova A.O., Boevink P.C., Young V., Grenville-Briggs L.J., van West P.,
Birch P.R., Whisson S.C. A novel Phytophthora infestans haustorium-specific membrane protein is required for infection of potato. Cell Microbiol. 2008;10(11):2271-2284. DOI 10.1111/j.14625822.2008.01206.x

Ballvora A., Ercolano M.R., Weiss J., Meksem K., Bormann C.A.,
Oberhagemann P., Salamini F., Gebhardt C. The R1 gene for potato
resistance to late blight (Phytophthora infestans) belongs to the leucine zipper/NBS/LRR class of plant resistance genes. Plant J. 2002;
30(3):361-371. DOI 10.1046/j.1365-313x.2001.01292.x.

Bradshaw J.E., Bryan G.J., Lees A.K., McLean K., Solomon-Blackburn R.M. Mapping the R10 and R11 genes for resistance to late
blight (Phytophthora infestans) present in the potato (Solanum tuberosum) R-gene differentials of Black. Theor. Appl. Genet. 2006a;
112(4):744-751. DOI 10.1007/s00122-005-0179-9.

Bradshaw J.E., Hackett C.A., Lowe R., McLean K., Stewart H.E., Tierney I., Vilaro M.D., Bryan G.J. Detection of a quantitative trait locus
for both foliage and tuber resistance to late blight [Phytophthora
infestans (Mont.) de Bary] on chromosome 4 of a dihaploid potato
clone (Solanum tuberosum subsp. tuberosum). Theor. Appl. Genet.
2006b;113(5):943-951. DOI 10.1007/s00122-006-0353-8.

Bradshaw J.E., Pande B., Bryan G.J., Hackett C.A., McLean K., Stewart H.E., Waugh R. Interval mapping of quantitative trait loci for
resistance to late blight [Phytophthora infestans (Mont.) de Bary],
height and maturity in a tetraploid population of potato (Solanum
tuberosum subsp. tuberosum). Genetics. 2004;168(2):983-995. DOI
10.1534/genetics.104.030056.

Brugmans B., Wouters D., van Os H., Hutten R., van der Linden G.,
Visser R.G., van Eck H.J., van der Vossen E.A. Genetic mapping
and transcription analyses of resistance gene loci in potato using
NBS profiling. Theor. Appl. Genet. 2008;117(8):1379-1388. DOI
10.1007/s00122-008-0871-7.

Chen Q., Tian Z., Jiang R., Zheng X., Xie C., Liu J. StPOTHR1, a
NDR1/HIN1-like gene in Solanum tuberosum, enhances resistance
against Phytophthora infestans. Biochem. Biophys. Res. Commun.
2018;496(4):1155-1161. DOI 10.1016/j.bbrc.2018.01.162.

Chowdappa P., Nirmal Kumar B.J., Madhura S., Mohan Kumar S.P.,
Myers K.L., Fry W.E., Cooke D.E.L. Severe outbreaks of late blight
on potato and tomato in South India caused by recent changes in the
Phytophthora infestans population. Plant Pathol. 2015;64:191-199.
DOI 10.1111/ppa.12228.

Chung I.M., Venkidasamy B., Upadhyaya C.P., Packiaraj G., Rajakumar G., Thiruvengadam M. Alleviation of Phytophthora infestans
mediated necrotic stress in the transgenic potato (Solanum tuberosum L.) with enhanced ascorbic acid accumulation. Plants (Basel ).
2019;8(10):365. DOI 10.3390/plants8100365.

Colignon B., Dieu M., Demazy C., Delaive E., Muhovski Y., Raes M.,
Mauro S. Proteomic Study of SUMOylation during Solanum tuberosum–Phytophthora infestans interactions. Mol. Plant. Microbe
Interact. 2017;30(11):855-865. DOI 10.1094/MPMI-05-17-0104-R.

Eschen-Lippold L., Landgraf R., Smolka U., Schulze S., Heilmann M.,
Heilmann I., Hause G., Rosahl S. Activation of defense against
Phytophthora infestans in potato by down-regulation of syntaxin
gene expression. New Phytol. 2012;193(4):985-996. DOI 10.1111/
j.1469-8137.2011.04024.x.

Fry W.E., McGrath M.T., Seaman A., Zitter T.A., McLeod A., Danies G.,
Small I.M., Myers K., Everts K., Gevens A.J., Gugino B.K., Johnson S.B., Judelson H., Ristaino J., Roberts P., Secor G., Seebold K.J.,
Snover-Clift K., Wyenandt A., Grünwald N. J., Smart C.D. The 2009
late blight pandemic in the eastern United States – causes and results.
Plant Dis. 2013;97(3):296-306. DOI 10.1094/PDIS-08-12-0791-FE.

Fu Z.Q., Guo M., Jeong B.R., Tian F., Elthon T.E., Cerny R.L., StaigerD.,
Alfano J.R. A type III effector ADP-ribosylates RNA-binding proteins and quells plant immunity. Nature. 2007;447(7142):284-288.
DOI 10.1038/nature05737.

Gebhardt C., Valkonen J.P. Organization of genes controlling disease
resistance in the potato genome. Annu. Rev. Phytopathol. 2001;39:
79-102. DOI 10.1146/annurev.phyto.39.1.79.

Grenville-Briggs L.J., Anderson V.L., Fugelstad J., Avrova A.O.,
Bouzenzana J., Williams A., Wawra S., Whisson S.C., Birch P.R.,
Bulone V., van West P. Cellulose synthesis in Phytophthora infestans is required for normal appressorium formation and successful
infection of potato. Plant Cell. 2008;20(3):720-738. DOI 10.1105/
tpc.107.052043.

Gyetvai G., Sønderkær M., Göbel U., Basekow R., Ballvora A., Imhoff M., Kersten B. , Nielsen K.L., Gebhardt C. The transcriptome
of compatible and incompatible interactions of potato (Solanum
tuberosum) with Phytophthora infestans revealed by DeepSAGE
analysis. PLoS One. 2012;7(2):e31526. DOI 10.1371/journal.pone.
0031526.

Halim V.A., Eschen-Lippold L., Altmann S., Birschwilks M., Scheel D.,
Rosahl S. Salicylic acid is important for basal defense of Solanum
tuberosum against Phytophthora infestans. Mol. Plant. Microbe Interact. 2007;20(11):1346-1352. DOI 10.1094/MPMI-20-11-1346.

Henriquez M.A., Soliman A., Li G., Hannoufa A., Ayele B.T., Daayf F.
Molecular cloning, functional characterization and expression of
potato (Solanum tuberosum) 1-deoxy-d-xylulose 5-phosphate synthase 1 (StDXS1) in response to Phytophthora infestans. Plant Sci.
2016;243:71-83. DOI 10.1016/j.plantsci.2015.12.001.

Ingram D.S. The expression of R-gene resistance to Phytophthora infestans in tissue cultures of Solanum tuberosum. J. Gen. Microbiol.
1967;49(1):99-108. DOI 10.1099/00221287-49-1-99.

Ingram D.S., Robertson N.F. Interaction between Phytophthora infestans and tissue cultures of Solanum tuberosum. J. Gen. Microbiol.
1965;40(3):431-437. DOI 10.1099/00221287-40-3-431.

Katsui N., Murai A., Takasugi M., Imaizumi K., Masamune T., Tomiyama K. The structure of rishitin, a new antifungal compound
from diseased potato tubers. J. Chem. Soc. Chem. Commun. 1968;1:
43-44. DOI 10.1039/C19680000043.

Koch A., Biedenkopf D., Furch A., Weber L., Rossbach O., Abdellatef E., Linicus L., Johannsmeier J., Jelonek L., Goesmann A.,
Cardoza V., McMillan J., Mentzel T., Kogel K.H. An RNAi-based
control of Fusarium graminearum infections through spraying of
long dsRNAs involves a plant passage and is controlled by the fungal silencing machinery. PLoS Pathog. 2016;12(10). DOI 10.1371/
journal.ppat.1005901.

Kuć J. Phytoalexins from the Solanaceae. In: Bailey J.A., Mansfield J.W. (Eds.). Phytoalexins. Blackie; Glasgow; London, 1982;
81-105.

Kuć J., Rush J.S. Phytoalexins. Arch. Biochem. Biophys. 1985;236(2):
455-472. DOI 10.1016/0003-9861(85)90648-4.

Lim P.O., Lee I.C., Kim J., Kim H.J., Ryu J.S., Woo H.R., Nam H.G.
Auxin response factor 2 (ARF2) plays a major role in regulating
auxin-mediated leaf longevity. J. Exp. Bot. 2010;61(5):1419-1430.
DOI 10.1093/jxb/erq010.

Louwes K.M., Hoekstra R., Mattheij W.M. Interspecific hybridization between the cultivated potato Solanum tuberosum subspecies
tuberosum L. and the wild species S. circaeifolium subsp. circaeifolium Bitter exhibiting resistance to Phytophthora infestans (Mont.)
de Bary and Globodera pallida (Stone) Behrens: 2. Sexual hybrids.
Theor. Appl. Genet. 1992;84(3-4):362-370. DOI 10.1007/BF0022
9495.

Mangeon A., Junqueira R.M., Sachetto-Martins G. Functional diversity
of the plant glycine-rich proteins superfamily. Plant Signal Behav.
2010;5(2):99-104. DOI 10.4161/psb.5.2.10336.

Mattheij W.M., Eijlander R., de Koning J.R., Louwes K.M. Interspecific hybridization between the cultivated potato Solanum tuberosum
subspecies tuberosum L. and the wild species S. circaeifolium subsp.
circaeifolium Bitter exhibiting resistance to Phytophthora infestans
(Mont.) de Bary and Globodera pallida (Stone) Behrens: 1. Somatic
hybrids. Theor. Appl. Genet. 1992;83(4):459-466. DOI 10.1007/
BF00226534.

Mosquera T., Alvarez M.F., Jiménez-Gómez J.M., Muktar M.S., Paulo M.J., Steinemann S., Li J., Draffehn A., Hofmann A., Lübeck J.,
Strahwald J., Tacke E., Hofferbert H.R., Walkemeier B., Gebhardt C.
Targeted and untargeted approaches unravel novel candidate genes
and diagnostic SNPs for quantitative resistance of the potato (Solanum tuberosum L.) to Phytophthora infestans causing the late blight
disease. PLoS One. 2016;11(6):e0156254. DOI 10.1371/journal.
pone.0156254.

Muktar M.S., Lübeck J., Strahwald J., Gebhardt C. Selection and validation of potato candidate genes for maturity corrected resistance to
Phytophthora infestans based on differential expression combined
with SNP association and linkage mapping. Front Genet. 2015;6:
294. DOI 10.3389/fgene.2015.00294.

Müller K.O., Behr L. Mechanism of Phytophthora-resistance of potatoes. Nature. 1949;163(4143):498-499. DOI 10.1038/163498a0.

Odeny D.A., Stich B., Gebhardt C. Physical organization of mixed protease inhibitor gene clusters, coordinated expression and association with resistance to late blight at the StKI locus on potato chromosome III. Plant Cell Environ. 2010;33(12):2149-2161. DOI 10.1111/
j.1365-3040.2010.02213.x

Pajerowska-Mukhtar K., Stich B., Achenbach U., Ballvora A., Lübeck J., Strahwald J., Tacke E., Hofferbert H.R., Ilarionova E., Bellin D., Walkemeier B., Basekow R., Kersten B., Gebhardt C. Single
nucleotide polymorphisms in the allene oxide synthase 2 gene
are associated with field resistance to late blight in populations of
tetraploid potato cultivars. Genetics. 2009;181(3):1115-1127. DOI
10.1534/genetics.108.094268.

Park C.J., Park C.B., Hong S.S., Lee H.S., Lee S.Y., Kim S.C. Characterization and cDNA cloning of two glycine- and histidine-rich antimicrobial peptides from the roots of shepherd’s purse, Capsella
bursa-pastoris. Plant Mol. Biol. 2000;44(2):187-197. DOI 10.1023/
a:1006431320677.

Park T.H., Vleeshouwers V.G., Huigen D.J., van der Vossen E.A., van
Eck H.J., Visser R.G. Characterization and high-resolution mapping
of a late blight resistance locus similar to R2 in potato. Theor. Appl.
Genet. 2005;111(3):591-597. DOI 10.1007/s00122-005-2050-4.

Poland J.A., Balint-Kurti P.J., Wisser R.J., Pratt R.C., Nelson R.J.
Shades of gray: the world of quantitative disease resistance. Trends
Plant Sci. 2009;14(1):21-29. DOI 10.1016/j.tplants.2008.10.006.

Quattrocchio F., Verweij W., Kroon A., Spelt C., Mol J., Koes R. Ph5
of Petunia is an R2R3 MYB protein that activates vacuolar acidification through interactions with basic-helix-loop-helix transcription
factors of the anthocyanin pathway. Plant Cell. 2006;18(5):12741291. DOI 10.1105/tpc.105.034041.

Rauscher G., Simko I., Mayton H., Bonierbale M., Smart C.D., Grünwald N.J., Greenland A., Fry W.E. Quantitative resistance to late
blight from Solanum berthaultii cosegregates with R(Pi-ber): insights in stability through isolates and environment. Theor. Appl.
Genet. 2010;121(8):1553-1567. DOI 10.1007/s00122-010-1410-x.

Restrepo S., Myers K.L., del Pozo O., Martin G.B., Hart A.L.,
Buell C.R., Fry W.E., Smart C.D. Gene profiling of a compatible
interaction between Phytophthora infestans and Solanum tuberosum
suggests a role for carbonic anhydrase. Mol. Plant Microbe Interact.
2005;18(9):913-922. DOI 10.1094/MPMI-18-0913.

Robertson N.F., Friend J., Aveyard M., Brown J., Huffee M., Homans A.L. The accumulation of phenolic acids in tissue culture
pathogen combinations of Solanum tuberosum and Phytophthora
infestans. J. Gen. Microbiol. 1968;54(2):261-268. DOI 10.1099/
00221287-54-2-261.

Rohwer F., Fritzemeier K.H., Scheel D., Hahlbrock K. Biochemical
reactions of different tissues of potato (Solanum tuberosum) to zoospores or elicitors from Phytophthora infestans: Accumulation of
sesquiterpenoid phytoalexins. Planta. 1987;170(4):556-561. DOI
10.1007/BF00402991.

Ruocco M., Ambrosino P., Lanzuise S., Woo S.L., Lorito M. , Scala F.
Four potato (Solanum tuberosum) ABCG transporters and their expression in response to abiotic factors and Phytophthora infestans
infection. J. Plant Physiol. 2011;168(18):2225-2233. DOI 10.1016/
j.jplph.2011.07.008.

Santa J.D., Berdugo-Cely J., Cely-Pardo L., Soto-Suárez M., Mosquera T., Galeano M.C.H. QTL analysis reveals quantitative resistant loci for Phytophthora infestans and Tecia solanivora in tetraploid potato (Solanum tuberosum L.). PLoS One. 2018;13(7). DOI
10.1371/journal.pone.0199716.

Simko I. Comparative analysis of quantitative trait loci for foliage
resistance to Phytophthora infestans in tuber-bearing Solanum
species. Am. J. Pot. Res. 2002;79:125-132. DOI 10.1007/BF0288
1521.

Slaymaker D.H., Navarre D.A., Clark D., del Pozo O., Martin G.B.,
Klessig D.F. The tobacco salicylic acid-binding protein 3 (SABP3)
is the chloroplast carbonic anhydrase, which exhibits antioxidant activity and plays a role in the hypersensitive defense response. Proc.
Natl. Acad. Sci. USA. 2002;99(18):11640-11645. DOI 10.1073/
pnas.182427699.

Solomon-Blackburn R.M., Stewart H.E., Bradshaw J.E. Distinguishing
major-gene from field resistance to late blight (Phytophthora infestans) of potato (Solanum tuberosum) and selecting for high levels
of field resistance. Theor. Appl. Genet. 2007;115(1):141-149. DOI
10.1007/s00122-007-0550-0.

Stewart H.E., Bradshaw J.E., Pand B. The effect of the presence of
R-genes for resistance to late blight (Phytophthora infestans) of
potato (Solanum tuberosum) on the underlying level of field resistance. Plant Pathology. 2003;52(2):193-198. DOI 10.1046/j.13653059.2003.00811.x.

Tan M.Y., Hutten R.C., Celis C., Park T.H., Niks R.E., Visser R.G.,
van Eck H.J. The R(Pi-mcd1) locus from Solanum microdontum
involved in resistance to Phytophthora infestans, causing a delay
in infection, maps on potato chromosome 4 in a cluster of NBSLRR genes. Mol. Plant Microbe Interact. 2008;21(7):909-918. DOI
10.1094/MPMI-21-7-0909.

Tomiyama K., Takakuwa M., Takase N. The metabolic activity in
healthy tissue neighbouring the infected cells in relation to resistance to Phytophthora infestans (Mont.) de By in potatoes. Phytopathol. Z. 1958;31:237-250.

Van der Vossen E., Sikkema A., Hekkert B., Gros J., Stevens P., Muskens M., Wouters D., Pereira A., Stiekema W., Allefs S. An ancient R gene from the wild potato species Solanum bulbocastanum
confers broad-spectrum resistance to Phytophthora infestans in
cultivated potato and tomato. Plant J. 2003;36(6):867-882. DOI
10.1046/j.1365-313x.2003.01934.x.

Vert G., Walcher C.L., Chory J., Nemhauser J.L. Integration of auxin
and brassinosteroid pathways by Auxin Response Factor 2. Proc.
Natl. Acad. Sci. USA. 2008;105(28):9829-9834. DOI 10.1073/pnas.
0803996105.

профилактика и борьба на Sadogolik.ru


Автор admin На чтение 7 мин Просмотров 50 Опубликовано

  • болезни и вредители
  • фитофтороз
  • картофель
  • томаты
  • профилактика
  • борьба

Фитофтороз — чрезвычайно вредоносное заболевание растений, прежде всего пасленовых (картофель, томат, перец, баклажан), поражающий так же клещевину, гречиху, землянику, цитрусовые и др.

В наибольшей степени проявляется во второй половине лета, при высокой влажности и относительно низкой температуре (12-25 градусов). Обычно в ночное время, когда выпадает много росы, или с наступлением дождливого периода.

Возбудителем заболевания являются паразитические грибы Phytophthora порядка Peronosporales.

С пораженных надземных органов растений зооспоры фитофторы смываются влагой и попадают в почву или на наземные органы растений через небольшие ранки, поражая клубни, листья, стебли и плоды.

Заболевание проявляется  серо-бурыми пятнами (отсюда второе название заболевания — “серая гниль”), нередко окруженными кольцом белой плесени или покрытыми легким паутинистым налетом. Растения быстро погибают, плоды теряют товарный вид, причем не только на грядке, но и в процессе транспортировки или хранения.

Болезнь легко предотвратить при помощи несложных профилактических мер. И даже в случае заболевания, при условии регулярной проверки растений, его легко можно пресечь с первых симптомов.

Фитофтороз картофеля

Фитофтороз картофеля проявляется  образованием на листьях (обычно по краям) крупных бурых расплывчатых пятен. На нижней стороне листа во влажную погоду появляется белый налет — споры гриба. Больные листья быстро отмирают. На клубнях заболевание характеризуется появлением бурых свинцово-серых пятен, постепенно превращающихся в ржавую гниль.

Фитофтороз — самое вредоносное заболевание картофеля в большинстве стран мира. Главная опасность болезни — невероятно быстрая скорость ее развития. От единичных больных кустов в течение 1 недели может заразиться вся посадка. Болезнь распространяется при смывании спор грибов с листьев на почву. Клубни, на которые при выкапывании попадают споры грибов, поражаются фитофтерозом даже во время хранения. При поражении более 10% листьев остановить развитие болезни невозможно, поэтому профилактические меры необходимо принимать с появлением первых всходов.

Профилактика

Для посадки подбирают здоровые клубни и сорта картофеля, устойчивые к фитофтерозу.

Для повышения устойчивости растений к болезни картофель удобряют повышенными дозами  фосфорно-калийных удобрений.

Посадки опрыскивают микродозами меди или комплексами микроудобрений и фунгицидами.

Кусты окучивают, чтобы клубни не оказывались на поверхности.

За неделю-две до выкапывания скашивают и убирают ботву.  

Урожай убирают в сухую погоду.

Меры борьбы

Начиная с фазы смыкания ботвы и до периода цветения грядки дважды обрабатывают  системными медьсодержащими или комбинированными фунгицидами — оксихомом, арцеридом, ридомилом МЦ и т. п. Интервал между обработками должен составлять 10-14 дней. В случае, если заболевание проявилось рано, будет достаточно однократного опрыскивания.

После цветения используют контактные (защитные) фунгициды — хлорокись меди, купроксат, дитан М-45. Обработку проводят с интервалом 7-8 дней.

В фазе образования клубней применяют препарат Алюфит, он защитит клубни картофеля. В сырую погоду посадки обрабатывают один раз в две недели.

Препараты следует чередовать, применяя один вид фунгицида не более двух раз за сезон.

Фитофтороз томатов

На листьях и стеблях томата при заболевании образуются серо-бурые пятна разнообразной формы, обычно со светло-зеленой каймой по кругу. С нижней стороны листьев при влажно погоде заметен белый налет — споры гриба-возбудителя.  Соцветия чернеют, засыхают цветоносы и чашелистики. На пораженных плодах появляются твердые коричневые пятна расплывчатой формы. Плод постепенно буреет и в конечном итоге загнивает.

Фитофтороз активно развивается после сильных туманов и продолжительных дождей, особенно сильно при сильном понижении ночной температуры и резким перепадам дневных и ночных температур, приводящим к растрескиванию плодов и стеблей томатов. Часто заболевание передается от картофеля.

Профилактика

Для посадки выбирают сорта, устойчивые к заболеванию.

Посадки томатов на максимальное расстояние удаляют от картофельных грядок.

Для выращивания томатов выбирают наиболее благоприятные условия — хорошо проветриваемые и максимально освещенные места, без застоя влаги и воздуха. В местах, где есть небольшой ветер, споры плесени не будут связываться с растениями, а сами растения после росы и дождя будут быстрее сохнуть, что ограничит спороношение грибов.

Перед посевом желательно обработать семена однопроцентным раствором марганцовокислого калия (1 г на 100 мл воды) в течение 20-25 минут. После обработки семена следует промыть и подсушить.

Для повышения устойчивости растений к болезни увеличивают дозу фосфорно-калийных удобрений (1 ст ложка а 5 л воды, по 1,5 л под каждое растение). Недостаток питательных веществ в почве способствует развитию заболевания — ослабленные растения не в состоянии справиться с болезнью.

Для повышения устойчивости к фитофторозу проводят внекорневую подкормку растений раствором борной кислоты (1 ч ложка на 10 л воды, 1 л на 1 кв метр).

Выращивание помидоров изолированно в теплицах ограничивает посадки от попадания на них спор грибов с других культур и спасет от неблагоприятных условий среды.

Полив растений осуществляют в первой половине дня, чтобы к вечеру влажность была минимальной.

Обращаются с растениями бережно, стараясь не допускать надломов и порезов стеблей и листьев и растрескивания плодов.

Мульчируя почву вокруг грядок с томатами, можно способствовать уменьшению влажности воздуха и уберечь растения от попадания на них влаги с поверхности земли.

После сбора урожая необходимо убрать все растительные остатки, а почву перекопать на глубину 20 см. При выращивании томатов в теплицах лучше полностью заменить верхний слой почвы.

При возможности необходимо соблюдать севооборот культур. Томат не желательно высаживать на то же самое место ранее чем через четыре года после предыдущей посадки.

Меры борьбы

В случае, если томаты все таки оказались поражены фитофторозом необходимо незамедлительно приступить к лечению растений.

Чем раньше выявлена болезнь — тем больше шансов спасти растение и избежать распространения заболевания.

Первыми поражаются нижние листья томатов  и стебли. Последними появляются пятна на плодах.

Больные листья необходимо удалить сразу же при обнаружении. Это необходимо делать крайне осторожно, так как споры грибка при тряске могут попасть на здоровые растения. Для этой цели удобно использовать садовый нож или ножницы.

Поврежденные плоды тоже следует срезать и уничтожить.

Следующий этап — лечение, направленное на предотвращение повторных заболеваний томатов. Растения обрабатываются медьсодержащими фунгицидами — хлорокисью меди (Хом) — 40 г на 10 л воды, купроксатом — 25-50 г на 10 л воды, Орданом — 25 г на 5 л воды или Таносом. Повторное опрыскивание проводят через одну-две недели. Важно помнить, что последнюю обработку фунгицидами проводят за 20 дней до сбора урожая.

Если ночная температура сильно снижается и существует угроза развития фитофтороза, с грядок собирают зеленые плоды, дезинфицируют их в горячей воде (1,5-2 мин при 60°С), тщательно высушивают и оставляют дозревать в темном помещении при 25°С.

Основные фунгициды

Фунгициды подразделяют на защитные (или контактные) и системные.

Защитные фунгициды действуют только на поверхности растений или семян, убивая споры грибов и прекращая их развитие. Такие фунгициды применяют в профилактических целях.

Системные фунгициды проникают внутрь растения, передвигаются по его сосудистой системе, предотвращают болезнь и искореняют инфекцию внутри растения. Однако их применение часто приводит к появлению резистентности (устойчивости) грибкового заболевания. Поэтому для эффективной борьбы с фитофторой необходимо чередовать препараты  с различным механизмом действия.

Медьсодержащие препараты контактного или комбинированного действия — Абига-Пик, Медный купорос, Оксихом, Хом, Бродская смесь. Хорошие средства для профилактических мер. Вовремя проведенное опрыскивание значительно снижает потери урожая от фитофтороза.

Биологические фунгициды — Алирин – Б, Альбит, Фитоспорин-М. Могут применяться в борьбе с фитофторозом, однако не так действенны как медьсодержащие фунгициды.

Системно-контактные комбинированные препараты нового поколения — Акробат МЦ, Дитан М-45, Ордан, Превикур, Профит Голд, Ридомил Голд МЦ, Ровраль, Скор, Фундазол. Обладают защитным, лечебным и противоспорообразующим действием. Эффективные средства в профилактической борьбе с фитофторозом.

При обработке химическими веществами очень важно соблюдать технику безопасности и использовать средства индивидуальной защиты: халат, очки, резиновые перчатки, респиратор, головной убор. Растения обрабатывают в сухую безветренную погоду. Обработанные участки не трогают в течение 3-7 дней. Повторную обработку проводят через 7-14 дней. Последнее опрыскивание должно проводиться не менее чем за 20 дней до сбора урожая.

Помните, что химические средства защиты можно и нужно применять только тогда, когда все другие возможности исчерпаны.

Выберите правильный фунгицид для защиты картофеля

Используете ли вы правильные фунгициды против болезней картофеля, с которыми вы пытаетесь бороться? Понимание того, как работают фунгициды, может помочь вам выбрать правильный продукт и применить его для достижения наилучшего эффекта. Вот некоторые вещи, которые следует учитывать при планировании борьбы с болезнями в следующем сезоне.

Знай патоген

Заболевания растений вызывают многие различные типы патогенов: грибы, оомицеты, бактерии, фитоплазмы, вирусы и другие.

У картофеля альтернариоз вызывает настоящий грибок Alternaria solani .

Ранняя гниль ( Alternaria solani )

Фитофтороз вызывается оомицетом Phytophthora infestans . Это важно знать, потому что фунгициды, контролирующие настоящие грибы, не всегда контролируют оомицеты, и наоборот.

Фитофтороз ( Phytophthora infestans )
Фото Бена Миллета

Порошкообразная парша вызывается Spongospora subterranea f.сп. subterranea, патоген, который более тесно связан с простейшими, чем с грибами. Не существует хороших средств борьбы с мучнистой паршой после того, как возбудитель был завезен в поле — нет фунгицидов, нацеленных на этот вид возбудителя.

Порошкообразная парша ( Spongospora subterranea f. sp. subterranea)
Фото A. J. Гевенс

Типы фунгицидов

Мы используем термин «фунгицид» для описания многих типов биоцидов, которые контролируют патогены. Но большинство фунгицидов нацелены на определенные группы патогенов.Правильнее было бы называть их фунгицидами, оомицидами [sic], бактерицидами, нематоцидами и т. д.

Широкий спектр против узкого спектра

Фунгициды, такие как хлороталонил (например, Bravo, Echo), метирам (например, Polyram) и манкоцеб (например, Dithane, Penncozeb и средства для обработки семян, содержащие MZ), известны тем, что обладают широким спектром действия против многих видов грибков и оомицеты и используются для подавления множества болезней. Медь- и серосодержащие продукты обладают некоторой активностью в отношении грибов, оомицетов и бактерий.Эти продукты являются скорее исключением, чем правилом — большинство фунгицидов имеют более узкую направленность.

Защитное и лечебное, контактное и системное

Защитные фунгициды наносят на здоровые растения, чтобы предотвратить рост или проникновение патогенов в ткани растений, но они не могут вылечить существующие инфекции и должны применяться до заражения растения. Многие защитные средства представляют собой контактные фунгициды, которые прилипают к поверхности растений и не впитываются в них.В эту категорию входят все упомянутые выше продукты широкого спектра действия.

Лечебные фунгициды могут действовать внутри растения, чтобы остановить рост патогена. Они работают лучше всего, когда применяются до заражения или в течение первых часов или дней после заражения, но лечебные фунгициды не остановят вспышку заболевания на поздних стадиях. Лечебные фунгициды обычно являются системными, что означает, что они поглощаются растением и в некоторой степени перемещаются в другие части растения.

«Системные» фунгициды

Фунгициды, которые классифицируются как «системные», обычно делятся на три категории в зависимости от того, насколько они могут перемещаться внутри растения:

  • Трансламинар
  • Системный в ксилеме
  • Полностью системно во флоэме
  • Трансламинарные фунгициды

Трансламинарные фунгициды распространяются по поверхности листьев или проникают через ткани растения, но не перемещаются в сосудистой системе растения. Если ваше применение фунгицида покрывает только верхние части листьев, трансламинарные продукты могут перемещаться по листу к нижней поверхности. Однако листья, расположенные ниже в кроне, и те, которые вырастают после применения, не будут защищены. Headline (пираклостобин, BASF) и Endura (боскалид, BASF) представляют собой трансламинарные фунгициды, которые могут быть эффективными в борьбе с ранней гнилью при использовании в рамках регулярно запланированной программы защитного опрыскивания. Эти продукты следует использовать поочередно с другими фунгицидами, отличающимися по способу действия, чтобы снизить риск заражения A.solani развивает к ним устойчивость (см. www.frac.info для получения дополнительной информации об устойчивости к фунгицидам).

Системные фунгициды

Системные фунгициды, транслоцированные в ксилеме, по существу перемещаются вверх по растению, так как ксилема перемещает воду и питательные вещества в основном в одном направлении — от корней к листьям. Эти фунгициды не будут сильно перераспределяться на нижнюю часть кроны, если их наносить только на верхушки растения. Вот почему этикетки трансламинарных и ксилемомобильных системных фунгицидов подчеркивают важность равномерного покрытия.Однако фунгициды, подвижные в ксилеме, могут продвигаться вверх для защиты нового роста, если их концентрация в растении адекватна.

Для борьбы с болезнями, передающимися через почву, некоторые системные фунгициды вносятся непосредственно в почву, часто в виде опрыскивания в борозды при посадке или в виде ленточного внесения в ряд после появления всходов. Примерами фунгицидов, перемещающихся по ксилеме, используемых таким образом, являются Ридомил Голд (мефеноксам, Syngenta) для подавления розовой гнили и Pythium, а также Quadris (азоксистробин, Syngenta) для борьбы с раком стебля Rhizoctonia или серебристой паршой.Эти фунгициды не попадают в цель (корни, столоны или клубни), если их обработка затрагивает только листву.

Полностью системные фунгициды

Полностью системные фунгициды перемещаются по флоэме, которая перемещает фотосинтаты и некоторые питательные вещества вверх и вниз по растению. Продукты фосфорной кислоты (например, Phostrol, NuFarm) являются единственными полностью системными фунгицидами. Если их нанести на листву, они могут перемещаться по всему растению. Эти средства часто наносят на листву с целью защиты клубней от таких болезней, как розовая гниль и фитофтороз.

К сожалению, существует распространенное заблуждение, что слово «системный» на этикетке фунгицида означает, что продукт будет перемещаться по растению. Большинство фунгицидов, для которых на этикетке указано «системный», являются переносчиками ксилемы. Непонимание этого может иметь большое влияние на то, насколько хорошо ваше применение фунгицидов борется с целевым заболеванием.

Примечание автора. Эта статья основана на презентации, сделанной моим коллегой и фитопатологом доктором Линдси дю Туа на конференции Тихоокеанской северо-западной овощной ассоциации 2018 года.Она использовала примеры фунгицидов от болезней лука, но принципы те же.

7
7
5

Выберите правильный фунгицид для защиты картофеля

Кэрри Хаффман Вохлеб — адъюнкт-профессор/региональный специалист по картофелеводству, овощным и семенным культурам в Университете штата Вашингтон. Все истории автора смотрите здесь.

Обработка семян фитофтороза | CropWatch

Растущий с семенами фитофтороз

(подготовлено совместно с Dr.Гэри Франк, Univ. Вайоминг)

Бесполые формы фитофтороза (Phytophthora infestans) зимуют только в инфицированных живых тканях растений. Например, исследования, проведенные в Ирландии в течение 50 лет, показали, что большинство вспышек фитофтороза может быть связано с инокулятом, который распространяется из зараженных семян, добровольческого картофеля и выбракованных куч. Наиболее важными источниками фитофтороза в производственном регионе, вероятно, являются отбракованные кучи и семенные клубни.Эти клубни могут казаться здоровыми, но нести фитофтороз, который в конечном итоге распространяется на ваш урожай. Добровольный картофель также играет роль в развитии болезней на орошаемых Высоких равнинах, в зависимости от его способности пережить зиму. В конечном счете, независимо от того, распространяется ли фитофтороз от отбракованных куч, семенных клубней или добровольцев, именно инфицированный клубень позволяет грибу выживать между вегетационными сезонами.

Выживание фитофторозного гриба в клубнях было предложено Беркли в 1846 году, так что это не новая идея.Де Бари установил в 1876 г., что ростки, образованные инфицированными клубнями, могут быть заражены P. infestans и что эти ростки могут выживать достаточно долго, чтобы достичь поверхности почвы и произвести спорангии. Таким образом, эти ростки возбудителя служат очагами инфекции, из которых распространяется фитофтороз. Пытаясь повторить работу Де Бари, ученые редко наблюдали ростки инфекционных заболеваний, потому что они обнаружили, что зараженные клубни обычно разлагаются до того, как растения могут появиться. Ван дер Зааг определил, что только около 1 процента инфицированных семенных клубней действительно дают начало зараженным растениям. Однако он также определил, что для начала ежегодных эпидемий фитофтороза в Нидерландах необходимо всего одно зараженное растение на квадратный километр (245 акров)!

Недавно ученые-картофелиды начали переосмысливать то, как фитофтороз распространяется среди семенных клубней. Поскольку грибок образует споры на поверхности инфицированных клубней, могут ли они распространиться на окружающие здоровые клубни в рассадной партии при обычных методах обрезки и обработки? Исследования в штате Мэн, Северной Дакоте, Вашингтоне, Вайоминге и других районах показали, что U.Изоляты фитофтороза S. легко распространяются от зараженных к здоровым семенным клубням при обработке и резке. Таким образом, возможно, основным источником инокулята являются не только семенные клубни, пораженные фитофторозом, поскольку 99% из них разлагаются до появления всходов, но и здоровые семенные клубни, которые заражаются незадолго до посадки.

Химический контроль. Обработка кусочков семян фунгицидами, такими как тиофанат-метил, манкоцеб и цимоксанил, была наиболее эффективной в восстановлении способности инокулированных семян к укоренению растений.При еженедельном применении защитного фунгицида, такого как хлороталонил-Zn или манкоцеб, не было поражений фитофторозом стеблей или листвы в результате переносимого с семян инокулята. Эффекты урожайности зависели от эффектов обработки насаждений. Если насаждение было увеличено, то увеличилась и урожайность. Обычно обнаруживается фитотоксичность от любого лечения. Важно понимать, что вы не можете вылечить зараженную рассаду, применяя обработку фунгицидами, а также то, что обработка рассады не защитит листву.

Хотя большинство производителей согласны с тем, что увеличение всхожести является желательным преимуществом обработки семян, не забывайте, что растения, которые появляются из семян, зараженных фитофторозом, могут в конечном итоге служить источником инокулята, от которого распространяется фитофтороз. Следовательно, действительно ли желательно увеличить всхожесть, применяя фунгицид к семенам, или каждый сеянец, несущий фитофтороз, должен сгнить в земле, прежде чем из него получится растение? Хотя ответ не сразу очевиден, если вы всегда начинаете с рассады, которая ранее не подвергалась воздействию фитофтороза, применение фунгицида обеспечит дополнительный уровень защиты, который предотвратит непреднамеренное распространение инокулята фитофтороза в ваших семенах.Промаркированные фунгицидами обработки семян должны снизить риск посадки инфицированных семян. Фунгициды для обработки семян являются важным компонентом комплексной программы борьбы с фитофторозом.

Источники информации

  • Ламберт, Д.Х., А.И. Карриер и М.О. Оланья. 1998. Передача Phytophthora infestans через срезанные семена картофеля. Амер Дж. Potato Res 75: 257-263.
  • Бойд, А.EW 1980. Развитие фитофтороза картофеля (Phytophthora infestans) после посадки инфицированных семенных клубней. Анна. заявл. биол. 95:301-309.
  • Де Бари, А. 1876. Исследования природы картофельного грибка Phytophthora infestans. Дж. Роял Агр. Soc., Англия, серия 2, 12:239-269.
  • Доули Л.Дж. и Э. О’Салливан. 1991. Спороношение Phytophthora infestans (Mont.) de Bary на поверхности больных клубней и распространение от клубня к клубню во время обработки.Исследования картофеля 34: 295-296.
  • McKay, R. 1957. Ретроспектива пятидесятилетних вспышек фитофтороза картофеля в Ирландии, 1907-1956 гг. Журнал кафедры Vol. LIII 5-10, Университетский колледж, Дублин, Ирландия.
  • Мельхус, И.Э. 1915. Спячка Phytophthora infestans в ирландском картофеле. БАНКА. 5:71-102.
  • Ван Дер Зааг, Д. Э. 1956. Перезимовка и эпидемиология Phytophthora infestans, tevens enigen nieve bestrijdingsmogelijkheden.Tijdschrift над plantenziekien 62:89-156.

Фосфит защищает от фитофтороза картофеля и томатов в тропическом климате и имеет различную токсичность в зависимости от изолята Phytophthora infestans. Берч и др., 2012; Диас, 2012). Картофель является третьей по важности продовольственной культурой в мире после пшеницы и риса, и его выращивают более чем в 160 странах (Диас, 2012; Кинг и Славин, 2013). С 2007 года в развивающихся странах производится больше картофеля, чем в промышленно развитых (ФАО, 2008). Более миллиарда человек регулярно потребляют картофель, и он является важным источником дохода для миллионов фермеров (Devaux et al., 2014). Помидор — широко культивируемая полевая культура в странах Африки к югу от Сахары, которая в основном выращивается для получения дохода (Fufa et al.

, 2011). Это одна из региональных экспортных культур Эфиопии (Gemechis et al., 2012).

Во многих африканских странах с низким уровнем дохода, таких как Эфиопия, картофель стал важной сельскохозяйственной культурой, особенно в высокогорных и среднегорных районах (Haverkort et al., 2012). В Руанде это одна из шести приоритетных культур страны (FAO, 2017). Однако урожайность в этих странах, как правило, низкая, 8-10 тонн на га -1 , по сравнению со среднемировым показателем, который составляет 17 тонн на га -1 (ФАО, 2008).Основными причинами низкой продуктивности являются плохое качество семян, методы распределения и управления, а также отсутствие доступа к фунгицидам (Haverkort et al., 2012; Gebru et al., 2017). Как и в случае с картофелем, средняя урожайность томатов в Эфиопии низкая, 7 т/га -1 , по сравнению с урожайностью в Америке, Европе и Азии в пять-семь раз выше (Balcha et al., 2015).

Фитофтороз, вызываемый оомицетом Phytophthora infestans (Mont. ) de Bary, представляет собой одну из основных угроз выращиванию картофеля и томатов во всем мире.Этот патоген присутствует во всех основных районах выращивания картофеля и представляет собой серьезную проблему для картофелеводов в Эфиопии (Bekele et al., 2011; Haverkort et al., 2012). В Восточной Африке недавнее популяционное исследование с использованием микросателлитных маркеров показало, что европейский штамм 2_A1 (ранее обозначаемый как KE-1) доминировал в популяции картофеля, тогда как, за исключением Кении, штамм US-1, по-видимому, сохраняется в томатах (Shimelash et al. ., 2016; Ньороге и др., 2018). Из-за давления фитофтороза наблюдалось смещение времени производства от основного сезона дождей к засушливому сезону, чтобы избежать заражения фитофторозом, даже если урожай снижается из-за небольшого количества дождей (Forbes et al., 2007; Хаверкорт и др., 2012). Это напоминает практику высокогорья Мексики, где картофель сажают до начала сезона дождей, чтобы избежать фитофтороза (Forbes et al. , 2007). В Эфиопии потеря урожая из-за фитофтороза в сезон дождей оценивается в 70%, но также сообщалось о полной гибели урожая (Бекеле и Яйну, 1996).

Использование фунгицидов является основной стратегией борьбы с фитофторозом картофеля и томатов. Тем не менее, в Эфиопии применялась более комплексная борьба с фитофторозом, которая сочетает устойчивость хозяина и культурные практики, такие как ранняя посадка (Guchi, 2015).Однако доступность фунгицидов и знания фермеров о передовой практике использования фунгицидов ограничены. Например, в Эфиопии и других развивающихся странах Африки сообщалось о плохом использовании надлежащих средств защиты (Mekonnen and Agonafir, 2002; Lekei et al., 2014; Mattah et al., 2015). Поэтому существует острая необходимость в поиске альтернатив обычным фунгицидам в развивающихся странах. С этой целью использование индукторов устойчивости растений (PRI) можно рассматривать как часть комплексной борьбы с фитофторозом картофеля и томатов.

Индуцированная устойчивость полезна против многих патогенов растений, включая оомицеты, и может быть вызвана воздействием на растения биологических или химических индукторов (Vallad and Goodman, 2004; Walters et al. , 2005; Alexandersson et al., 2016). Примером может служить фосфит, который является производным соли фосфористой кислоты (H 3 PO 3 ) (Mcdonald et al., 2001). Считается, что фосфит имеет двойной механизм действия: прямой эффект, подавляющий спорообразование грибов и замедляющий рост (Smillie et al., 1989; Guest and Grant, 1991), а также косвенный эффект, действующий как PRI, путем быстрой стимуляции защитных механизмов растений. Последний был изучен на молекулярном уровне как на модельном растении Arabidopsis thaliana , так и на картофеле (Massoud et al., 2012; Burra et al., 2014). У картофеля наблюдается явное сходство в профилях экспрессии генов после применения хорошо изученных PRI бета-аминомасляной кислоты (БАМК) и фосфита (Bengtsson et al., 2014; Burra et al., 2014). Фосфит также может защищать от других патогенов, и недавно было показано, что обработанный фосфитом картофель также снижает количество личинок картофельной моли (PTM) в поле, а также определяемых самок PTM в анализе выбора (Mulugeta et al. , 2019). Полезность фосфита против фитофтороза листьев ранее была показана в полевых условиях в развивающихся странах (Kromann et al., 2012). Примечательно, что влияние на урожайность еще мало изучено. Недавно было показано, что в умеренном климате фосфит в сочетании с обычными фунгицидами подавляет фитофтороз картофеля и защищает урожай так же хорошо, как и обычные фунгициды (Liljeroth et al., 2016).

На сегодняшний день в Эфиопии используется мало альтернатив фунгицидам, несмотря на необходимость борьбы с фитофторозом картофеля и томатов, и никакие фосфитные препараты, отдельно или в сочетании с обычными фунгицидами, ранее не тестировались для борьбы с фитофторозом картофеля и помидоров. помидоры.Кроме того, не сообщалось об эффективности фосфита против P. infestans в томатах. Наконец, несмотря на более широкое использование фосфита в сельскохозяйственных системах во всем мире, до сих пор мало исследований было посвящено потенциальным различиям в эффективности фосфита в зависимости от изолята P. infestans , что может повлиять на структуру популяции патогена.

Это исследование проводилось в течение трех последовательных полевых сезонов для оценки эффективности фосфита в борьбе с фитофторозом в прохладной тропической высокогорной среде.Далее в исследовании оценивалась эффективность фосфита и комбинаций фосфита с обычным фунгицидом против фитофтороза и измерялась полученная выгода от урожайности. Прямое влияние фосфита на рост мицелия, продукцию спорангиев и прорастание различных изолятов P. infestans из Европы и Эфиопии оценивали in vitro .

Фитофтороз картофеля / Садоводство RHS

Возбудитель фитофтороза представляет собой микроскопический грибоподобный организм, споры (спорангии) которого легко отрываются от зараженной листвы и могут переноситься ветром на большие расстояния.Для заражения требуется длительное увлажнение поверхности (несколько часов); вот почему болезнь так серьезна влажным летом. Затем возбудитель быстро распространяется по тканям растения, убивая клетки. Во влажных условиях из свежеубитых тканей вырастают стебли, несущие спорангии, и болезнь может быстро распространяться по урожаю. Споры, образующиеся на листьях и стеблях, также могут быть смыты в почву проливным дождем и могут заразить клубни, с которыми они соприкасаются.

Возбудитель зимует в пораженных клубнях картофеля, оставленных в земле (а также оставленных по краям полей в случае некоторых товарных культур, пораженных в прошлом году). Хотя вполне возможно, что томатный или картофельный материал, оставленный в индивидуальном саду, может стать источником болезни на следующий год, подавляющее большинство инфекций в садах возникает из-за переносимых ветром спорангиев, происходящих из других садов и участков, а также из товарного картофеля. урожай. В Великобритании вспышки могут возникать с июня, обычно раньше всего на юго-западе.

 Присутствие новых штаммов фитофтороза в Великобритании означает, что патоген теперь может продуцировать покоящиеся споры (ооспоры) в пораженных тканях растений. Ооспоры выделяются из гниющих тканей и загрязняют почву. Эти покоящиеся споры еще предстоит найти в Великобритании, но анализ недавних вариаций штаммов фитофтороза, встречающихся на картофеле в некоторых частях Великобритании, позволяет предположить, что они могут быть произведены. В настоящее время мало что известно об их выживании и их потенциале как источника заболевания, но исследования продолжаются, и в ближайшие несколько лет, вероятно, появится больше информации.Однако, поскольку ооспоры являются устойчивыми структурами, если они образуются в зараженной листве, вполне возможно, что они также выживут во многих системах компостирования в домашних садах. Вот почему предпочтительнее утилизировать отходы пораженных культур другими способами. Муниципальные и коммерческие системы компостирования должны достигать очень высоких температур, необходимых для уничтожения ооспор и других устойчивых пропагул патогенов.

Приступы фитофтороза, происходящие в конце лета, могут привести к дефолиации картофеля, но если болезнь возникает, когда клубни уже созрели, и их собирают до того, как они заразятся, мало что теряется. Тем не менее, ранние атаки могут быть разрушительными, и спустя более 150 лет после ирландского картофельного голода фитофтороз по-прежнему остается самой серьезной болезнью картофеля как для садоводов, так и для коммерческих производителей.

Противофитофторный эффект отдельных штаммов Pseudomonas, ассоциированных с картофелем: из лаборатории в поле

Abstract

Фитофтороз, вызываемый оомицетом Phytophthora infestans , является наиболее разрушительным заболеванием картофеля. В органическом земледелии фитофтороз контролируется повторным применением продуктов на основе меди, которые негативно влияют на окружающую среду.Чтобы найти альтернативные решения для борьбы с фитофторозом, мы ранее выделили большую коллекцию бактерий из филлосферы и ризосферы картофеля. Здесь мы сообщаем об антагонистическом потенциале этих штаммов при совместном культивировании с P. infestans , а также с другими патогенами картофеля. Затем мы сосредоточились на трех штаммах Pseudomonas и сравнили их защитное действие против фитофтороза с действием хорошо известных штаммов биоконтроля в planta с использованием высокопроизводительного анализа листовых дисков с автоматическим анализом изображений. При опрыскивании листьев картофеля в теплице штаммы сохраняли жизнеспособность не менее 15 дней. В полевых условиях популяции уменьшались быстрее, но все протестированные штаммы все еще можно было получить через 8 дней. Наиболее активный штамм in vitro , P. chlororaphis R47, также был лучшим средством защиты на листовых дисках растений, выращенных в тепличном эксперименте, но его защитный потенциал не мог быть проверен в полевых условиях из-за неблагоприятных условий заражения.Тем не менее, его защитный эффект против P. infestans в planta , его выживаемость в филлосфере, а также его способность колонизировать ризосферу картофеля при очень высокой плотности популяции предполагают потенциал для полевого применения, например, в форме обработки клубней. или спрей для листьев.

Ключевые слова: Phytophthora , Pseudomonas , Solanum tuberosum , листовой диск, биоконтроль

Введение

в сознании производителей и потребителей. Однако производству сельскохозяйственных культур угрожают различные абиотические и биотические факторы, такие как изменение климата или появление возбудителей болезней. В производстве картофеля потери урожая в основном связаны с оомицетом Phytophthora infestans , который вызывает фитофтороз и может при благоприятных условиях заражения привести к массовой гибели урожая в течение нескольких дней (Fry, 2008). В традиционном сельском хозяйстве с фитофторозом обычно борются путем многократного применения различных фунгицидов, тогда как продукты на основе меди обычно используются в органическом земледелии (Кук и др., 2011; Аксель и др., 2012). Ввиду ее накопления в почве и ее токсичности для почвенной фауны использование меди представляет опасность для окружающей среды, и для обеспечения устойчивого производства картофеля необходимы альтернативные решения по борьбе с фитофторозом (Dorn et al., 2007). Организмы биоконтроля были предложены в качестве предполагаемой альтернативы химическим средствам защиты от болезней (Velivelli et al. , 2014). Эффективность таких антагонистических бактерий или грибков в полевых условиях доказана, и некоторые из них доступны в качестве коммерческих продуктов и регулярно используются фермерами, например, Pseudomonas chlororaphis MA 342, который защищает зерновые от некоторых грибковых заболеваний, передающихся через семена (Johnsson et al. ., 1998), или Bacillus amyloliquefaciens FZB42, который действует как стимулятор роста растений и как агент биоконтроля (Chen et al., 2007). Однако, несмотря на то, что во многих исследованиях изучалось влияние микробных инокулянтов на фитофтороз (обзор в Axel et al., 2012), ни одно из них до сих пор не продемонстрировало защиту от фитофтороза в полевых условиях. Это может быть, по крайней мере частично, из-за быстрого распространения Phytophthora во влажных условиях, что опосредовано образованием спорангиев, которые, в зависимости от температуры, могут либо напрямую заражать ткани растения, либо высвобождать подвижные зооспоры, которые, в свою очередь, заражают новые листья. (Фрай, 2008).Таким образом, успешный агент биоконтроля должен быть способен ингибировать не только рост мицелия патогена, но также образование и/или прорастание его спорангиев, как недавно сообщалось о штамме Lysobacter , продуцирующем циклические дипептиды (Puopolo et al., 2014). В попытке найти такой агент биоконтроля против фитофтороза картофеля мы ранее выделили бактериальные штаммы из филлосферы и ризосферы картофеля, которые, как мы предположили, были адаптированы к растению-хозяину (Hunziker et al., 2015). В этой более ранней работе мы сообщали о способности бактерий, связанных с картофелем, ингибировать рост и спороношение Phytophthora infestans посредством выделения летучих органических соединений (Hunziker et al., 2015). Однако разрыв между результатами, полученными в контролируемых лабораторных условиях, и истинным защитным потенциалом в полевых условиях может быть очень большим (Dorn et al., 2007), и необходимы дальнейшие исследования, включающие проверку способности штаммов приживаться с достаточной плотностью в целевой среде. органы растений (корни ипобеги) и их эффективность как в посевах , так и в полевых условиях. В настоящем исследовании эти вопросы рассматриваются с использованием подмножества штаммов Pseudomonas , которые показали многообещающие защитные эффекты in vitro. Оценивали способность штаммов к колонизации корней и листьев, а также их влияние на рост и развитие растений. Затем их защитный эффект в planta был проанализирован с использованием недавно разработанного высокопроизводительного анализа листовых дисков. Наконец, выживаемость и эффективность штаммов в полевых условиях контролировали в эксперименте на микроучастке.

Материалы и методы

Химические вещества и питательные среды

Для культивирования бактерий использовали среду Луриа-Бертани (LB). Чашки с агаром LB готовили путем растворения 20 г L -1 бульона Difco LB, Lennox (BD), смешанного с 15 г агара L -1 (агар-агар, ERNE surface AG). Среду PIA готовили путем растворения 45 г L -1 Pseudomonas Isolation Agar (Fluka) в дистиллированной воде, к которой добавляли 20 мл L -1 глицерина (Sigma-Aldrich). Грибы и оомицеты росли на ржаном агаре (RA), солодовом агаре (MA) или картофельно-декстрозном агаре (PDA). РА готовили путем кипячения 200 г зерен ржи (озимой ржи сорта Пикассо 95) в водопроводной воде в течение ок. 1 час. Отфильтрованную жидкость (сетка 1,5 мм) доводили до объема 1 л водопроводной водой и добавляли 20 г агара L -1 . Для начального скрининга (таблица ) использовали RA без глюкозы, для более поздних экспериментов к RA добавляли 5 г L -1 глюкозы. MA готовили с 15 г агара L -1 Difco солодового экстракта (BD) и 12 г агара L -1 , а PDA содержал 39 г L -1 PDA (Oxoid).Один эксперимент проводили на водном агаре (WA), содержащем dH 2 O и 6 г агара L -1 . При необходимости добавляли рифампицин (PanReac AppliChem) в концентрации 50 мкг/мл -1.

Таблица 1

Антагонистическая активность 32 бактериальных штаммов, выделенных из ризосферы (R) или побегов (S) полевых растений картофеля.

11 11

S24

P116

99

92

9317

Штамм Принадлежность P.inf H.sol R.SOL F. Oxy 2 9001 9

R47 P. Choloraphis

8 69 81 35
R32 P. vranovensis 10 14 51 88 41
R84 П.marginalis 22 36 81 92 38
R82 P. marginalis 15 12 91 82 73
S49 П. Шогезсепз 46 37 73 79 51
R73 Bacillus sp. 7 27 94 94 84 88 88 88
R54 Bacillus SP 13 18 98 83 87
S50 П. moraviensis 10 66 76 91 58
S01 Streptomyces sp. 12 60 104 60 81
R01 П. moraviensis 30 66 95 98 33
R76 П. Шогезсепз 25 38 91 93 81
S35 стр. marginalis 27 67 81 80 73
S06 П. frederiksbergensis 101 21 82 99 66
+
П. frederiksbergensis 92 22 95 85 75
S22 стр.syringae 85 22 81 95 89
S19 П. frederiksbergensis 100 21 89 91 72
R95 П. Лини 72 21 93 99 97
R02 Р . Veronii 56 60

60 88 91 92 92
S46 Curtbacterium SP 35 78 95 95 84 97 97 97
S27 Arthrobacter SP 50 nd nd 90 94
R116

R116

R74 903Frederiksbergensis 89 28 101 92

92 83
R31 Sporosarcina Sp. 39 й й 98 99
S34 П. jessenii 96 30 90 99 81
R85 Rhodococcus sp. 41 84 84 104 104 91 79
R29 Bacillus SP 65 53 100 94 87
S04 П. frederiksbergensis 97 22 97 98 91
R61 Arthrobacter sp. 8 113 113 115 99 92 92
S25 Curtbacterium SP 77 97 71 90 98 93 93 93
R60 Artrrobacter SP 15 132 112 87 93 93
R75 P. Frederiksbergensis 82 095 98 98 98 86 88 88
R42 Microbacterium Sp. 14 153 107 92 89
R96 Flavobacterium SP 111 96 99 99 9000 9317

93

штаммов, условия культуры и подготовка приостановлений инокуляции

Бактериальные штаммы, используемые в этом исследовании, описаны в предыдущем публикации (Hunziker et al. , 2015). Кроме того, Pseudomonas protegens CHA0 и Pseudomonas DSMZ 13134 были включены в качестве контроля в большинстве экспериментов. Dickeya dianthicola был получен от S. Schaerer (Agroscope). Для экспериментов в теплице и в полевых условиях производные выбранных штаммов, устойчивые к рифампицину, получали штрихом чистой бактериальной культуры высокой плотности на чашку LB, содержащую рифампицин (50 мкг/мл -1). Через 2 дня стали видны спонтанно устойчивые к рифампицину колонии; одну колонию для каждого штамма высевали штрихом на свежий LB-планшет, содержащий ту же концентрацию рифампицина.Через 2 дня для каждого стабильного мутантного штамма готовили глицериновый раствор. Бактериальные штаммы хранили при температуре -80°С в 25% глицерине для длительного хранения. Во всех экспериментах использовали полиспоровый изолят Phytophthora infestans , отобранный в 2001 г. в Цюрихе Аффольтерн (предоставлен H. Krebs, Agroscope). Этот изолят выращивали на RA в темноте при 18°C ​​и регулярно переносили на срезы клубней картофеля для пассажей-хозяев. Грибы Rhizoctonia solani , Helminthosporium solani , полученные от P.Frei (Agroscope), выращивали на КПК и МА соответственно. Fusarium oxysporum был выделен из зараженного пассажа хозяина P. infestans в 2013 г. и выращен на RA. Длительное хранение всех грибов проводили в 25% глицерине при температуре -80°С. Все патогены картофеля непрерывно выращивали на агаризованной среде, а агаровые пробки (ø 5 мм) переносили на чашки со свежей средой, когда были достигнуты границы предыдущей чашки. Планшеты хранили в темноте при температуре около 20°С. Для получения суспензий спорангиев P. infestans мицелий отделяли от заросших чашек с агаром и суспендировали в водопроводной воде.Суспензию фильтровали через автоклавированную марлю и количество спорангиев доводили до желаемой конечной концентрации с помощью камеры Тома (Marienfeld Superior, Германия). Суспензию хранили при 5°С в темноте до использования. Если не указано иное, бактериальные суспензии готовили путем сбора культур с агара LB в течение ночи и ресуспендирования клеток в 0,9% NaCl. Для применения в полевых микроделах плотность регулировали добавлением водопроводной воды.

In Vitro Скрининг бактериальных штаммов на активность против различных патогенов картофеля

Тридцать два бактериальных штамма показали антагонистический потенциал в предварительном скрининге (Hunziker et al., 2015) были протестированы в двухкультурном анализе на ингибирующее действие на пять различных патогенов картофеля: оомицет P. infestans , грибы H. solani , R. solani , F. oxysporum и бактерия . Д. диантикола . Бактерии-антагонисты и патогены выращивали на одной и той же чашке Петри, заполненной либо RA ( P. infestans, F. oxysporum ), PDA ( H. solani, R. solani ), либо LB ( D). диантикола ).Два штамма, S27 и R31, не могли быть выращены на КПК и поэтому не тестировались против H. solani, и R. solani. Сроки применения бактериальных штаммов варьировали, так как патогены картофеля демонстрировали разную скорость роста. Это произошло в тот же день для D. dianthicola , через 1 день для R. solani и F. oxysporum , через 4 дня для P. infestans и через 7 дней для H. solani . Каждый гриб или оомицет инокулировали в виде пробки и D.dianthicola инокулировали в виде капли 10 мкл жидкой культуры, доведенной до OD 570 = 1, в центр чашки Петри. Три капли по 10 мкл ночных культур бактерий, доведенных до OD 570 = 1 (или LB для контроля), наносили на край чашек Петри. Планшеты инкубировали при 20°C в темноте и оценивали площадь роста патогена с помощью анализа изображений (через 3 дня для R. solani , 7 дней для D. dianthicola и F. oxysporum , 14 дней для ). П.infestans и 28 дней для H. solani ) с использованием программы обработки изображений ImageJ (Schneider et al., 2012). Этот эксперимент проводили в четырех повторностях на штамм бактерий (пять контрольных чашек). Средний рост патогенов в присутствии различных штаммов сравнивали со средним ростом патогенов, выращенных в отсутствие штаммов (контроль), и рассчитывали процент роста в контроле.

Эксперимент в теплице

Устойчивые к рифампицину производные отобранных штаммов Pseudomonas (R47, R76, S35, CHA0, Pseudomonas DSMZ 13134, см. раздел о получении этих штаммов выше) инокулировали на ростки клубней картофеля и их влияние на развитие растений (cv.Шарлотта и cv. Виктория) и для их выживания в ризосфере. Для эксперимента по инокуляции проростков бактериальные клетки суспендировали в 0,9% NaCl и доводили до OD 570 = 1. Ростки увлажняли путем опрыскивания их раствором, содержащим 0,9% NaCl, а затем пипеткой добавляли 1,5 мл суспензии бактериальных клеток. к ростку. Для предотвращения вымывания инокулированных клеток горшки не поливали в течение первых 24 ч после инокуляции. Кроме того, суспензии бактерий тех же штаммов распыляли на листья картофеля (∼15 мл на растение) для оценки выживаемости популяции бактерий в течение 15 дней.Инокуляцию ростков картофеля проводили за 1 день до посадки в горшки путем нанесения 1,5 мл неотмытых бактериальных клеток, суспендированных в 0,9% NaCl, и доводили до OD 570 = 1 (0,9% NaCl использовали для контроля). Каждую обработку повторяли шесть раз. Стадию ВВСГ и высоту растений (расстояние между поверхностью почвы и апикальной меристемой) измеряли один раз в неделю в период от всходов до цветения (4–33 дня после посадки). Выживание штаммов Pseudomonas , инокулированных ростками, в ризосфере оценивали через 11 недель после посадки в горшки.Для этого отмытую корневую систему двух повторных растений разрезали на мелкие кусочки и суспендировали в 15 мл 0.9% NaCl. После обработки ультразвуком в течение 5 минут суспензию серийно разбавляли в десять раз и по 100 мкл каждого разведения помещали на планшет PIA с добавлением рифампицина (50 мкг L -1 ). Через 3 дня инкубации при 20°С в темноте подсчитывали колониеобразующие единицы (КОЕ) из наиболее подходящего разведения. Выживаемость бактерий при опрыскивании листьев картофеля (ОП 570 = 1) исследовали в течение 2 недель в дни 1, 3, 8 и 15.Из каждой обработки вырезали три листовых диска диаметром 5 мм и суспендировали в 200 мкл 0,9% NaCl. Растительную ткань гомогенизировали с помощью небольшого пластикового пестика и после обработки ультразвуком и десятикратного серийного разведения (см. выше) по 5 мкл каждого разведения дважды наносили на планшет LB, содержащий рифампицин, который затем поднимали, чтобы капля упала и распределила КОЕ. . Через 3 дня инкубации при 20°С подсчитывали КОЕ от наиболее подходящего разведения.

Создание высокопроизводительного анализа дисков листьев картофеля с автоматическим анализом изображений для мониторинга

P.infestans Заражение

Для определения подходящей концентрации спорангиев, а также стратегии применения, направленной на оптимальное инфекционное давление (развитие некроза и появление спорангиофоров на поверхности листа), суспензии спорангиев в различных концентрациях (6.25 . 10 4 , 1.25 . 10 5 , 2,50148. 10 . 10 5 , 5 . , 5 . 10 5 Sporangia ML -1 ) были применены в капли 10 мкл на верхней или нижней стороне картофеля листовые диски (ø 17 мм), срезанные с растений картофеля сорта.Виктория через 39 дней после посадки. Листовые диски помещали на предварительно увлажненную фильтровальную бумагу в стандартную чашку Петри и инокулировали соответствующей суспензией спорангиев. Чашки Петри помещали в светонепроницаемый пластиковый бокс и инкубировали при 18°С в течение 8 дней. При появлении на листовых дисках первых признаков заражения (через 3 дня) с помощью зеркальной камеры (Canon EOS 700D) делали суточные снимки (размер 5184 × 3456) и нарастание некротизированной растительной ткани (3–7 дни) и спорангиофорного покрова ( день 8) был проанализирован с помощью макроинструкций автоматизированного анализа изображений, разработанных для этой цели в бесплатной программе ImageJ (см. Дополнительный материал).

Тестирование защитного потенциала бактерий, нанесенных на листовой диск, против

P. infestans

Используя этот недавно разработанный метод листового диска с автоматическим анализом изображения, влияние отдельных бактериальных штаммов ( Pseudomonas штаммов R47, R76, S35, CHA0 , ДСМЗ 13134) на прогрессирование заболевания отслеживали. Для этого суспензию бактерий и спорангиев смешивали и наносили на нижнюю сторону листовых дисков (сорт Виктория, 18 повторов). Конечная концентрация спорангиев составила 1.25 . 10 5 мл 5 мл -1 мл). Постановка эксперимента была такой же, как описано выше, и после нанесения 10 мкл объединенных суспензий листовые диски инкубировали в течение 8 дней при 18°С. Некротическая ткань листа и спорангиофоры измерялись с помощью макроинструкций автоматического анализа изображений (см. Дополнительный материал) через 4 дня после инокуляции и через 8 дней после инокуляции соответственно.Отдельный набор листовых дисков, инокулированных смешанной суспензией, использовали для получения микроскопических изображений спорангиев, которые подвергались воздействию бактерий в концентрации OD 570 = 3 (соответствует приблизительно 2 , 10 9 клеток). /мл). Снимки были сделаны через 4 дня после инокуляции, когда площадь некроза контрольной обработки достигала 60% площади листового диска.

Прорастание спорангиев

Анализировали прорастание спорангиев в смешанной суспензии спорангиев и бактерий при воздействии на спорангии штаммов с плотностью популяции OD 570 = 3, OD 570 = 0.3 и OD 570 = 0,03 (в качестве контроля использовали 0,9% NaCl). Пятнадцать микролитров смешанной суспензии наносили на пробку с 0,6% WA, помещенную на предметные стекла микроскопа. Поведение спорангиев при прорастании оценивали через 3 дня инкубации при 18°С в темноте. Лечение и контроль повторяли четыре раза и случайным образом помещали на предметные стекла. Дополнительные контрольные пробы ( n = 20) инкубировали отдельно от обработанных проб, чтобы проверить, будет ли какое-либо влияние на контрольные пробы, инкубированные на тех же предметных стеклах, что и обработанные пробы.Количество проросших спорангиев в пробке рассчитывали как процент проросших спорангиев по отношению к общему числу спорангиев (23-106 в пробке в зависимости от плотности спорангиев). Затем этот процент сравнивали с процентом всхожести контроля.

Эксперимент на микроплане

Для определения защитного потенциала бактериальных штаммов в полевых условиях в Цюрихе Аффольтерн, Швейцария, был проведен эксперимент на микроплане. Каждая микроделянка состояла из одного ряда из пяти растений картофеля.Для каждой обработки четыре повтора были распределены по четырем блокам, в которых они были распределены случайным образом. Каждый блок был окружен со всех сторон одним рядом бордюрных растений сорта Панда (низкая восприимчивость к фитофторозу). Блоки с бордюрами были отделены друг от друга одним рядом растений сорта Бинтье (высокая восприимчивость к фитофторозу). Растения (сорт Виктория) были посажены 15 апреля 2015 г. Расстояние между растениями 30 см, между рядами 70 см. С 44-го дня после посадки растения регулярно опрыскивали бактериальными взвесями выбранных штаммов (Р47, Р76, С35, СНА0 и Pseudomonas ДСМЗ 13134) согласно рекомендациям системы поддержки принятия решений по фитофторозу Bio-PhytoPRE ( Муса-Стинблок и Форрер, 2005).Интервал лечения составлял от 6 дней до 2 недель. Всего было проведено шесть обработок. Для получения суспензий ночные бактериальные культуры суспендировали в воде и добавляли 0,1% Nu-Film 17 ® (Andermatt Biocontrol), смачивающее средство, предназначенное для усиления адгезии клеток к поверхности листа. Концентрацию суспензий доводили до OD 570 = 1. Суспензии распыляли сверху и снизу на листья растений, при этом каждое растение получало приблизительно 50 мл суспензии за одно применение.После последнего опрыскивания, которое произошло через 106 дней после посева, выживаемость опрыскиваемых бактерий оценивали через 1 и 8 дней после этого последнего опрыскивания. Для этого вырезали три листовых диска (ø 17 мм) и суспендировали в 2 мл 0,9% NaCl. Затем ткань листа гомогенизировали с использованием гомогенизатора Polytron PT300 (Kinematica AG), с помощью которого образцы измельчали ​​при 6000 об/мин в течение примерно 30 с каждый. После 5 минут пребывания в ванне для обработки ультразвуком образцы серийно разбавляли в десять раз. Пять микролитров каждого разведения дважды наносили на пластину PIA, содержащую рифампицин, и инкубировали при 20°C в темноте.КОЕ рассчитывали из наиболее подходящего разведения через 3 дня инкубации. Для оценки защитного потенциала штаммов эксперимент с листовыми дисками проводили через 1 день после опрыскивания, как описано выше. Покрытие спорангиофоров оценивали через 6 дней после инокуляции листового диска.

Статистическая оценка

В начальном скрининге ( Таблица ) использовали тест Стьюдента t для сравнения ингибирования роста каждого бактериального штамма с отрицательным контролем.Оценка последующих экспериментов проводилась с помощью GraphPad Prism версии 5.01 (GraphPad Software, Сан-Диего, Калифорния, США), выполняя односторонний дисперсионный анализ с помощью апостериорных тестов Тьюки .

Результаты

Ингибирование роста патогенов штаммами бактерий, ассоциированными с картофелем, в двойных культурах

Тридцать два штамма бактерий, ассоциированных с картофелем, ранее идентифицированные как потенциально активные на основании выделения ими летучих веществ (Hunziker et al., 2015), были протестированы на их эффекты в анализах прямой конкуренции с пятью различными патогенами картофеля: оомицетом Phytophthora infestans , грибами Helminthosporium solani , Rhizoctonia solani , Fusarium oxysporum и бактерией Dickey.Среди этих 32 штаммов пять Pseudomonas были способны значительно ингибировать рост каждого целевого организма, хотя R. solani и F. oxysporum ингибировали в гораздо меньшей степени, чем P. infestans и H. solani ( Таблица ). Эта дифференциальная реакция целевых организмов на бактериальные штаммы была дополнительно проиллюстрирована, например, тем фактом, что R. solani в большей степени ингибировался в своем росте штаммами Pseudomonas , чем другими штаммами, в то время как штаммов Bacillus R73 и R54 удалось резко снизить рост как P.infestans и H. solani , а штамм Streptomyces S01 был лучшим ингибитором F. oxysporum (60% его контрольного роста) (таблица ). В пределах рода Pseudomonas , который в целом ингибировал P. infestans сильнее, чем другие мишени, все штаммы, родственные P. frederiksbergensis (например, S04, S06, S19, S24, R74), воздействовали на H. solani . более P. infestans . Напротив, два штамма Arthrobacter R61 и R60 резко снижали рост P.infestans , но практически не влиял на другие микроорганизмы-мишени. На основании этих результатов мы отобрали для дальнейшего анализа три многообещающих штамма, которые показали значительное in vitro ингибирование роста всех патогенов: P. chlororaphis R47, штамм с самым высоким in vitro ингибированием P. infestans. , а также P. fluorescens R76 и P. marginalis S35, которые показали сопоставимое ингибирование in vitro , но были выделены из разных частей растения (ризосфера для R76 и филлосфера для S35).В следующих экспериментах для целей сравнения были включены два контрольных штамма Pseudomonas : P. protegens CHA0 (Voisard et al., 1989) и Pseudomonas sp. ДСМЗ 13134.

Влияние бактериальных штаммов, инокулированных проростками, на рост и развитие растений картофеля

В качестве первого шага к оценке потенциала этих трех отобранных штаммов для практического применения была проведена оценка того, проявляли ли они какой-либо фитотоксический эффект при нанесении на растения картофеля. клубни картофеля.Бактериальные штаммы были инокулированы на ростки клубней двух разных сортов картофеля, Виктория (умеренно восприимчивый к фитофторозу) и Шарлотта (высоковосприимчивый к фитофторозу), за которыми наблюдали в течение 33 дней после посадки (, дополнительная фигура S1 ). Не наблюдалось существенной разницы в общем росте между растениями, развивающимися из инокулированных и не инокулированных ростков, что исключает фитотоксическое действие штаммов ( Рисунок ). Стимулирования роста также не наблюдалось, но некоторые штаммы вели к более постоянному росту, т.е.е., к меньшей изменчивости между отдельными растениями, например, P. fluorescens R76 у сорта Charlotte и P. protegens CHA0 у обоих сортов ( Рисунок ).

Влияние бактерий, инокулированных проростками, на рост сортов картофеля Шарлотта (А) и Виктория (В). Общий рост рассчитывали как AUGPC (площадь под кривой роста, d(BBCH)/dt) (см. Дополнительный рисунок S1 ). Показаны средние значения и стандартные ошибки.Инокуляция ростков не привела к каким-либо существенным изменениям в росте сорта. Шарлотта [ F (5) = 1,36, P = 0,27] или cv. Виктория [ F (5) = 0,74, P = 0,60], как определено с помощью однофакторного дисперсионного анализа.

Выживание штаммов в филлосфере и ризосфере растений картофеля

Способность трех отобранных штаммов к выживанию в филлосфере и ризосфере оценивали в эксперименте в теплице с использованием устойчивых к рифампицину производных штаммов.За выживаемостью бактерий в филлосфере следили через различные промежутки времени в течение 15 дней после распыления биопрепаратов на листья растений картофеля. После сильного снижения численности популяции в течение первых нескольких дней уровни оставались почти постоянными в течение второй недели и оставались на уровне ок. 100 КОЕ на см 2 ( Рисунок ). Все бактериальные штаммы сохранялись у двух испытуемых сортов в течение всего испытательного периода. Для выживания в ризосфере использовали промытые корни 11-недельных растений картофеля, инокулированных ростками.Численность извлеченных инокулированных бактерий показана полуколичественным образом в таблице . В целом количество КОЕ бактерий из корневой системы сорта Виктория было выше, чем из корневой системы сорта Шарлотта. Все штаммы смогли прижиться в ризосфере и конкурировать с естественным микробиомом картофеля, демонстрируя тем самым свою ризосферную компетентность. Штамм, первоначально извлеченный из филлосферы (S35), показал сходную с более высокой плотностью колонизации близкородственную P.fluorescens , выделенный из ризосферы (R76) (таблица ). Однако наибольшая способность к колонизации наблюдалась для P. chlororaphis R47: этот штамм был обнаружен не только в очень большом количестве в горшках, куда он был инокулирован, но и в значительных количествах извлекался из соседних горшков (горшки были случайным образом помещали в теплицу, но в поддоны, где они соединялись через дно при поливе), что свидетельствует об очень высокой ризосферной компетентности.Нельзя исключить, что из-за этой инвазии P. chlororaphis R47 другие штаммы были ограничены в их колонизации ризосферы и что данные, представленные в таблице , таким образом, занижают их истинный потенциал колонизации.

Выживание бактерий в филлосфере. Выживание опрыскиваемых бактерий на поверхности листьев измеряли в течение 15 дней у сортов Шарлотта (А) и Виктория (В) .Их численность через определенные промежутки времени показана в КОЕ см -2 (SEM, n = 6). Односторонний ANOVA выявил значительные различия между штаммами через 3 дня [ F (4) = 3,92, P = 0,013 для сорта. Шарлотта и F (4) = 5,01, P = 0,004 для сорта. Виктория], но ни один через 8 дней и только маргинальный для cv. Шарлотка в 15 дней [ F (4) = 2,77, P = 0,049].

Таблица 2

Выживание бактерий в ризосфере.

Инокулированный штамм R47
cv. Charlotte Control + R47 ++++ ++++ ++++
R76 ++ ++
S35 +++ ++ ++
13134 ++
CHA0 +++
CV.Victoria ++ R47 ++++ ++++ ++++ R76 R76 +++ ++
S35 +++ +++
13134 +++ +++ CHA0 CHA0 +++ +++

Оценка потенциала защиты штаммов

In Planta с использованием метода листовых дисков

В качестве следующего шага к оценке потенциала защиты бактериальных штаммов в Planta была разработана установка листовых дисков с высокой пропускной способностью (см. и Методы для получения подробной информации).Нанесение раствора спорангиев Phytophthora на нижнюю сторону листового диска приводило к более быстрому прогрессированию заболевания, чем при инокуляции спорангиев на верхнюю сторону (, дополнительная фигура S2 ). При этом капля, содержащая спорангии, оставалась на месте до конца эксперимента, тогда как при инокуляции на верхнюю сторону листового диска она часто беспорядочно распространялась и приводила к множественным стартовым точкам заражения. Для автоматизированного и количественного анализа данных в бесплатном программном обеспечении ImageJ была разработана макроинструкция для измерения развития некроза (3–7-е сутки) и образования спорангиофоров (8-е сутки).Используя 10 мкл капли 1,25 . 10 5 мл -1 раствор спорангиев привел к четко различимым кривым развития некроза и значительному покрытию спорангиофорами поверхности листового диска через 8 дней ( рисунок ).

Прогрессирование болезни на листовых дисках картофеля. Снимки делали ежедневно между 2 и 8 днями после инокуляции и обрабатывали для количественного определения площади некроза (2–7 дни) и продукции спорангиофоров (8 день). Показаны средние значения и стандартные ошибки ( n = 18).Снимки были сделаны при освещении сверху для измерения некроза и при освещении сбоку для измерения спорангиофоров. В день показывается одно репрезентативное изображение и его обработанный аналог.

С помощью установленного метода листовых дисков было исследовано влияние трех выбранных бактериальных штаммов на planta в теплице с использованием сорта картофеля Виктория. Виктория, а не Шарлотта, была выбрана для тепличных и полевых опытов из-за ее меньшей восприимчивости к фитофторозу.Листовые диски от инокулированных проростков растений картофеля не показали большей устойчивости к P. infestans , чем диски от неинокулированных контрольных растений, что свидетельствует о том, что инокулированные штаммы не индуцировали устойчивости (данные не представлены). Когда бактерии применялись на листьях в высокой концентрации, все штаммы, кроме P. marginalis S35, ингибировали образование некротических поражений, вызванных Phytophthora- ( Рисунок ). Однако при использовании десятикратного разведения инокулята только P.штамм protegens CHA0 значительно уменьшал площадь некроза, в то время как другие этого не делали. P. fluorescens R76, который сильно ингибировал образование некроза (8% поверхности листового диска против 48% для необработанного контроля), не смог уменьшить образование спорангиофоров ( Рисунок ). Напротив, P. chlororaphis R47 и P. protegens CHA0 значительно ингибировали продукцию спорангиофоров при обеих протестированных плотностях инокулята. Очень сильная зависимость от концентрации наблюдалась для Pseudomonas sp.DSMZ 13134, который обеспечивал превосходную защиту при применении в высоких концентрациях, но был неэффективен или даже способствовал инфицированию при применении в более низких концентрациях. Автоклав Pseudomonas sp. Клетки DSMZ 13134 не обеспечивали никакой защиты, что позволяет предположить, что живые бактерии необходимы для защиты растений от P. infestans.

Защитное действие штаммов на листовые диски. На листовые диски инокулировали спорангиев и бактерий. Образование некроза количественно определяли через 4 дня (A) с использованием макроинструкции (см. Дополнительный материал, макрос 1) и продукцию спорангиофоров через 8 дней (B) (макрос 2).OD = 3 представлен темными и OD = 0,3 светлыми полосами. Показаны средние значения и стандартные ошибки ( n = 18–20). Разные буквы обозначают статистически разные значения (апостериорный тест Тьюки : p <0,05).

Ингибирование прорастания спорангиев бактериальными штаммами

Первым этапом процесса заражения Phytophthora является прорастание спорангиев и/или зооспор. Поэтому мы оценили, способны ли бактериальные штаммы, использованные в экспериментах с листовыми дисками, ингибировать этот критический этап.Общая всхожесть в контрольных вариантах составила около 35%. При применении с высокой плотностью все штаммы вызывали значительное снижение процента проросших спорангиев ( Рисунок ). То же наблюдение можно было сделать с промежуточными плотностями, за исключением контрольного штамма P. protegens CHA0, который существенно не отличался от необработанного контроля. Низкая плотность бактерий (ОП = 0,03) оказалась неэффективной в снижении прорастания спорангиев (рис. ).В дополнение к снижению скорости прорастания при обработке бактериальными штаммами можно было наблюдать морфологические аномалии, такие как вздутие гиф и более короткие трубки прорастания ( Рисунок ). Корреляции между влиянием штаммов in vitro на прорастание спорангиев и защитным потенциалом, наблюдаемым на листовых дисках, не наблюдалось. Однако при микроскопическом наблюдении капель спорангиев, нанесенных на листовые диски, оказалось, что штамм S35, неспособный защищать листовые диски от P.infestans также не ингибировал прорастание спорангиев так резко, как другие штаммы (, дополнительная фигура S3 ).

Прорастание спорангиев Phytophthora infestans в присутствии бактерий. Спорангии и бактерии в различных концентрациях совместно инокулировали на пробки с агаром и через 3 дня подсчитывали процент проросших спорангиев. (А) Процент проросших спорангиев. Разные буквы указывают на значительные различия (апостериорный тест Тьюки : p < 0.05, н = 4). OD = 3 представлены темными, OD = 0,3 — промежуточными и OD = 0,03 — светлыми полосами. (B) Репрезентативные изображения спорангиев Phytophthora infestans , проросших в присутствии различных концентраций бактерий. Слева направо: уменьшение концентрации бактерий и увеличение прорастания спорангиев. Аномальная морфология, такая как набухание гиф, наблюдалась даже при воздействии низких концентраций бактерий (увеличенное изображение вверху справа).Полосы указывают 100 мкм.

Выживаемость и защитный потенциал штаммов в полевых условиях

Чтобы оценить, смогут ли выбранные нами штаммы защищать картофель от P. infestans в полевых условиях, мы провели эксперимент на микроделе, где растения картофеля регулярно опрыскивали взвеси бактериальных штаммов. После последнего применения оценивали как выживаемость, так и защитный потенциал. Через сутки после опрыскивания растений бактериальной взвесью все штаммы все еще присутствовали в относительно высокой численности (10 5 –10 6 см –2 ) ( рис. дней: через 8 дней можно было получить только несколько клеток на квадратный сантиметр листа.Микроделовой эксперимент был проведен для наблюдения за защитным действием штаммов в полевых условиях, т.е. при естественной инфекции P. infestans . Поскольку эта естественная инфекция была предотвращена очень жаркими и сухими погодными условиями в июле и августе, мы проверили защитный эффект штаммов с помощью нашей экспериментальной установки для листовых дисков. Это показало, что метод листовых дисков, по крайней мере, в наших экспериментах, лучше подходил для тепличных экранов, поскольку заражение растений, выращенных в открытом грунте, было гораздо менее эффективным ( Рисунок ).Инфицированные и неинфицированные контроли существенно не отличались друг от друга, что в основном было связано с меньшим уровнем заражения инфицированных контролей (см. также Рисунок ). Таким образом, несмотря на то, что после обработки штаммом P.moraviensis S35, а также двумя контрольными штаммами Pseudomonas sp. DSMZ 13134 и P. protegens CHA0, эти результаты следует интерпретировать с осторожностью.

Выживаемость инокулированных бактериальных штаммов в полевом эксперименте на микроделе. Обилие бактерий определяли на листовых дисках ( n = 4) опрысканных растений, собранных через 1 (А) и 8 (Б) дней после опрыскивания. Количество колоний через 8 дней существенно не отличалось между обработками в соответствии с однофакторным дисперсионным анализом [ F (4) = 1,13, P = 0,38], хотя через 1 день после опрыскивания наблюдались значительные различия. (Апостериорный тест Тьюки : p < 0,05, n = 4).

Защитное действие штаммов на листовые диски полевых растений.
Спорангии и бактерии Phytophthora infestans инокулировали на листовые диски, собранные с полевых растений, через 1 день после опрыскивания. Контроль (+) представляют собой листовые диски необработанных растений, инфицированных спорангиями P. infestans . Контроль (-) – листовые диски необработанных растений, не зараженных спорангиями. Продукцию спорангиофоров количественно определяли через 6 дней с использованием макроинструкции (см. Дополнительный материал, макрос 3).Показаны средние значения и стандартные ошибки ( n = 52–58, n контроль(-) = 14). Разные буквы обозначают статистически разные значения (апостериорный тест Тьюки : p <0,05).

Обсуждение

Использование микроорганизмов в качестве агентов биологической борьбы кажется привлекательной стратегией для устойчивой защиты растений: в последние десятилетия было предпринято много усилий для выделения, характеристики и использования микробных штаммов с этой целью, однако бактериальные антагонисты, доступные на рынке, пока лишь немногие (Velivelli et al., 2014). Действительно, для того чтобы такой агент биологической борьбы попал к фермеру, должно быть выполнено множество критериев (Köhl et al., 2011). Первым шагом, который обычно предпринимается для выбора кандидатов на биоконтролирующие агенты, является скрининг in vitro в лаборатории, подобный тому, который мы провели в отношении патогенов картофеля в настоящем исследовании (, таблица ). По сравнению с первым скринингом штаммов, ассоциированных с картофелем, описанным в (Hunziker et al., 2015), который был сосредоточен на летучих веществах, настоящая оценка потенциальной активности штаммов против широкого спектра патогенов картофеля дала несколько иные результаты: Штаммы Pseudomonas классифицируются как лучшие производители противогрибковых летучих веществ (Hunziker et al., 2015) также были очень активны в настоящем исследовании, другие, не относящиеся к штаммы Pseudomonas , такие как два штамма Bacillus R73 и R54 или Streptomyces S01, оказывали гораздо большее ингибирующее действие на патогены картофеля, когда их диффундирующие вещества, в игру вступили не только их летучие вещества. Более того, селективное ингибирование Helminthosporium solani штаммами, относящимися к виду P. frederiksbergensis , по-видимому, происходит из-за диффундирующих веществ, поскольку эти штаммы не продуцируют летучие соединения, ингибирующие H.solani (Hunziker et al., 2015).

Однако результаты, полученные в таких in vitro экспериментальных установках, представляют собой только метаболический потенциал штаммов, выращенных на довольно богатых лабораторных средах, и нет никакой гарантии, что штаммы, активные in vitro , также будут в планте. Причины появления этого первого экрана в лаборатории в основном связаны с нехваткой времени и места. Таким образом, разработка экономичной по времени и пространству процедуры скрининга, которая позволила бы тестировать агенты биологической борьбы на очень ранней стадии уже на растительном материале, а не на искусственных лабораторных средах, потенциально позволила бы получить штаммы-кандидаты, более подходящие для дальнейших исследований.Вот почему мы разработали метод листового диска с высокой пропускной способностью, позволяющий осуществлять мониторинг с течением времени и автоматическую количественную оценку прогрессирования заболевания с помощью анализа изображений. Основная трудность в разработке надежной макроинструкции для количественной оценки продукции спорангиофоров связана с белым фоном, происходящим из жилок и трихом листа. Тем не менее, при условии тщательной адаптации макроинструкций к каждой новой экспериментальной установке, автоматизированный метод количественного определения листовых дисков представляет собой большой шаг вперед для отбора перспективных штаммов биоконтроля, поскольку он предоставляет средства для получения количественных результатов с минимальными затратами времени и пространства. данные о потенциале защиты интересующих штаммов от болезней in planta .Несмотря на то, что в наших руках этот анализ хорошо подходил для растений, выращенных в теплицах, он не подходил для оценки прогрессирования болезни на материале из растений, выращенных в поле, поскольку контрольные растения (того же сорта Виктория) развили небольшую инфекцию (менее Заражено 20 % листовой поверхности по сравнению с более чем 30 % для листовых дисков тепличных растений, (рисунки и ). Ожидается, что выращенные в поле растения проявят базовый уровень устойчивости к болезням из-за разнообразных биотических и абиотических стимулов, с которыми они сталкиваются в природе (Walters, 2009).Кроме того, растения, выращенные в теплице, демонстрируют менее обильную и менее разнообразную микробную колонизацию, чем растения, выращенные в поле (данные не показаны), что также может объяснить их более высокую восприимчивость к инфекции P. infestans , поскольку роль микробиома растений в заболевании защита и индукция резистентности становятся все более очевидными (Bakker et al., 2013; Pieterse et al., 2014). Таким образом, метод листового диска и последующий автоматизированный анализ изображений, разработанный в настоящем исследовании, не предназначены для замены анализа всего растения и полевых испытаний, но представляют собой эффективный инструмент для замены скрининга in vitro и выбора антагонистов, которые способны для ингибирования патогена, когда оба организма растут на растении-хозяине, а не на богатой лабораторной среде.Поскольку совместная инокуляция как антагониста, так и патогена не позволила бы увидеть индуцированные эффекты, установку можно было бы адаптировать, либо применяя антагонисты за 1 день до патогена, либо опрыскивая антагонистами целые растения, а затем разрезая листовые диски, заражая их вирусом. P. infestans и мониторинг прогрессирования заболевания.

В нашем случае штамм, показавший наибольшую активность in vitro , оказался также наиболее эффективным при тестировании на листовых дисках растений, выращенных в теплицах ( Таблица , Рисунок ), хотя очень немногие штаммы отобранные в этом исследовании, не позволяют обобщать это наблюдение.Этот штамм Pseudomonas был аффилирован с видом P. chlororaphis в соответствии с его последовательностью rpoD (Hunziker et al., 2015), видом, к которому также принадлежит активный ингредиент продукта Cerall ® (Johnsson et al. и др., 1998; Веливелли и др., 2014). Эта принадлежность была подтверждена филогенетическим анализом на основе четырех генов домашнего хозяйства ( 16S рРНК , gyrB , rpoB , rpoD ), которые поместили этот штамм в кластер, состоящий из P.chlororaphis и штаммов P. protegens (De Vrieze et al., 2015). Оба вида являются частью более крупной группы P. fluorescens , и недавние филогенетические исследования указывают на тесную близость между P. chlororaphis и P. protegens (Gomila et al., 2015). Штаммы, принадлежащие к обоим видам, включают хорошо известные средства биоконтроля против патогенных грибов (Haas and Defago, 2005), а также против насекомых (Kupferschmied et al., 2013; Ruffner et al., 2013).Предварительная проверка геномного потенциала штамма P. chlororaphis R47 показала, что этот штамм обладает тем же набором антибиотиков, что и другие штаммы P. chlororaphis , согласно недавнему исследованию, сравнивающему штаммы Pseudomonas (Loper et al., 2012): геном P. chlororaphis R47 кодирует синтез антибиотиков цианистого водорода, феназинов, пирролнитрина и 2-гексил-5-пропил-алкилрезорцина (HPR) (данные не показаны), которые могут быть вовлечены в его анти- Phytophthora. деятельность.Более того, продукция сидерофоров (пиовердин, ахромобактин) также закодирована в геноме и может способствовать противогрибковой активности штаммов и, что, возможно, более важно, их замечательной ризосферной способности (Ghirardi et al., 2012). Действительно, штамм P. chlororaphis R47, по-видимому, значительно превосходил другие протестированные штаммы с точки зрения колонизации ризосферы (таблица ), что является важной особенностью, учитывая практические преимущества (выполнимость и экономическая эффективность) обработки клубней по сравнению с опрыскиванием листьев.Однако для успешного ингибирования фитофтороза на уровне побегов агент биологической борьбы должен быть способен либо индуцировать устойчивость, либо систематически колонизировать верхние части растений. Хотя индукция устойчивости у картофеля была показана для других штаммов Pseudomonas (Arseneault et al., 2014; Pieterse et al., 2014), листовые диски растений, инокулированных клубнем P. chlororaphis R47, не проявляли повышенной устойчивости к фитофторозом (данные не показаны), что позволяет предположить, что этот штамм не был способен индуцировать длительную устойчивость к фитофторозу после инокуляции клубней.Предварительные данные свидетельствуют о том, что P. chlororaphis R47 может перемещаться из клубней в верхние части растений, что является важным признаком защиты от фитофтороза. Такая эндофитная колонизация была показана для других стимуляторов роста растений и биоконтроля Pseudomonas , таких как P. poae в сахарной свекле (Zachow et al., 2015) или P. putida в картофеле (Andreote et al. , 2009).

Для неэндофитных микробов задача успешного применения в качестве опрыскивателя листьев особенно высока ввиду суровых условий, преобладающих в филлосфере, таких как УФ-облучение, а также экстремальные колебания температуры и влажности.В наших экспериментах в теплице все испытанные бактериальные штаммы были способны сохраняться в течение 2 недель, но в полевых условиях их численность снижалась более быстро, хотя все инокулированные штаммы можно было извлечь через 8 дней в нашем эксперименте на микроучастке ( Рисунок ). В дополнение к абиотическим стрессам, преобладающим в полевых условиях, более высокая сложность микробиома в полевых растениях также, вероятно, снижает способность интродуцированных бактерий приживаться как в листьях, так и в корнях из-за более высокой конкуренции, с которой они сталкиваются. .Таким образом, способность штаммов к колонизации может зависеть от микробиома, а также от сорта растения: в нашем анализе колонизации корней из ризосферы сорта Cv можно было извлечь постоянно больше бактерий. Виктория, чем от резюме. Шарлотта ( Стол ).

Как и во многих исследованиях, предшествовавших текущему, переход от теплицы к полю оказался сложным шагом. Однако мы отобрали только несколько штаммов, которые были предварительно проверены и охарактеризованы на основе экспериментов in vitro .Мы надеемся, что автоматизированный анализ картины прогрессирования болезни на основе листовых дисков, разработанный в рамках этого исследования, позволит пропустить этот первый трудоемкий этап испытаний in vitro и напрямую проверить защитный потенциал антагонистов на растительном материале из различные сорта картофеля, различающиеся по восприимчивости к фитофторозу. На втором этапе выбранные штаммы должны быть протестированы на их способность создавать достаточную плотность популяции на выращенных в поле растениях, которые содержат свой собственный сложный нативный микробиом, поскольку колонизация этих растений может быть более сложной, чем колонизация растений, выращенных в теплицах. менее сложные микробные сообщества.Благоприятные или антагонистические взаимодействия между инокулированным штаммом и резидентным микробиомом, состав которого будет меняться в зависимости от биотических и абиотических факторов, могут быть важными факторами, которые поддерживают или препятствуют успешному внедрению агента биоконтроля. Те штаммы, которые демонстрируют in planta антиомицетную активность в широком диапазоне культурных сортов, а также способность приживаться на уже колонизированных растениях, будут затем представлять лучших кандидатов для длительных полевых испытаний, чем штаммы, отобранные исключительно на основе in vitro. тестов в чашках Петри.Наконец, будущие исследования покажут, будет ли наилучшее использование агентов микробной борьбы для ограничения фитофтороза в производстве картофеля завтрашнего дня путем применения отдельных высокоэффективных штаммов или комбинации штаммов с разными и, следовательно, взаимодополняющими способностями, или в более глобальный подход, включающий инженерию микробиома и отбор на основе микробиома (Mueller and Sachs, 2015).

Новая стратегия длительной борьбы с фитофторозом картофеля путем однократного внесения в почву смеси оксатиапипролина в начале сезона

.21 августа 2020 г .; 15 (8): e0238148.

doi: 10.1371/journal.pone.0238148.

Электронная коллекция 2020.

Принадлежности

Расширять

принадлежность

  • 1 Факультет естественных наук Университета Бар-Илан, Рамат-Ган, Израиль.

Бесплатная статья ЧВК

Элемент в буфере обмена

Игаль Коэн и соавт.

ПЛОС Один.

.

Бесплатная статья ЧВК

Показать детали

Показать варианты

Показать варианты

Формат

АннотацияPubMedPMID

.21 августа 2020 г .; 15 (8): e0238148.

doi: 10.1371/journal.pone.0238148.

Электронная коллекция 2020.

принадлежность

  • 1 Факультет естественных наук Университета Бар-Илан, Рамат-Ган, Израиль.

Элемент в буфере обмена

Полнотекстовые ссылки
Параметры отображения цитирования

Показать варианты

Формат
АннотацияPubMedPMID

Абстрактный

Было показано, что обработка корней оксатиапипролином, бентиаваликарбом или их смесью Зорвек-Эндавиа [ZE (3+7, вес/вес)] обеспечивает длительную системную защиту от лиственных патогенов оомицетов, поражающих огурец, томат и базилик.Здесь мы сообщаем, что эти фунгициды могут эффективно защищать растения картофеля от фитофтороза при внесении в почву, в которой выращиваются такие растения картофеля. В двух полевых экспериментах, проведенных в 2019 и 2020 годах, растения картофеля, выращенные в контейнерах емкостью 64 л, обрабатывали оксатиапипролином, бентиаваликарбом или ZE в количестве 12,5, 25 или 50 мг д.в./пять растений в контейнере. Искусственные инокуляции Phytophthora infestans выявили дозозависимую защиту таких обработанных растений от фитофтороза в течение всего сезона.Интересно, что оксатиапипролин сохранялся в обработанной почве не менее 139 дней, обеспечивая системную защиту от фитофтороза следующих культур картофеля, выращенных на этой обработанной почве. Растения картофеля, выращенные в лёссовой почве в поле, либо опрыскивали, либо поливали ZE. Растения, обработанные через почву, были значительно лучше защищены от фитофтороза по сравнению с растениями, обработанными опрыскиванием. Данные демонстрируют новую стратегию сезонной защиты картофеля от фитофтороза путем однократного внесения ZE в почву.Системный характер оксатиапипролина и бентиаваликарба, входящих в состав ZE, обеспечивает перенос на листву двух фунгицидов с разным механизмом действия. Это сведет к минимуму риск развития устойчивости обработанных культур к любому фунгициду.

Заявление о конфликте интересов

Авторы заявили об отсутствии конкурирующих интересов.

Цифры

Рис 1. Системная защита картофеля Никола…

Рис. 1. Системная защита картофеля Никола от фитофтороза каждым из пяти фунгицидов…


Рисунок 1.Системная защита картофеля Никола от фитофтороза каждым из пяти внесенных в почву фунгицидов.

Шестинедельные растения картофеля, растущие в контейнере объемом 64 л, обрабатывали однократной обработкой почвы 1 л суспензии фунгицида, содержащей 0, 12,5, 25 или 50 мг фунгицида в форме действующего вещества. Листья (один сложный лист на растение) отделяли через 1–20 дней после обработки, инокулировали Phytophthora infestans в вегетационных камерах и визуально оценивали развитие фитофтороза через 7 дней после инокуляции.Различные буквы на кривых или столбцах указывают на значительное различие между средними значениями (n = 3) при α = 0,05.

Рис 2. Системная защита картофеля Никола…

Рис. 2. Системная защита картофеля Никола от фитофтороза 4-мя фунгицидами, примененными к…


Рис 2.Системная защита картофеля Никола от фитофтороза 4 внесенными в почву фунгицидами.

Шестинедельные выращенные в поле растения обрабатывали путем однократной обработки почвы 1 л суспензии фунгицида, содержащей 0, 12,5, 25 или 50 мг а.и. указанного фунгицида. Листья отделяли через 7 дней после замачивания почвы и инокулировали Phytophthora infestans в ростовой камере при 20°C. Фотография сделана через 7 дней после прививки.

Рис. 3.Системная защита картофеля Никола…

Рис. 3. Системная защита картофеля Никола от фитофтороза, вызванного устойчивым к MFX изолятом…


Рис. 3. Системная защита картофеля Никола от фитофтороза, вызванного устойчивым к MFX изолятом Phytophthora infestans , в полевых условиях.

растения картофеля, выращенные в контейнерах емкостью 64 л, обрабатывали пропиткой почвы 12,5, 25 или 50 мг суспензии фунгицида д.в. на контейнер (n = 3). Через 21 сут после обработки растения инокулировали спорангиальной взвесью изолята 164 возбудителя. Процент площади листа, занятой поражением фитофторозом, визуально регистрировали через различные промежутки времени после инокуляции. Различные буквы на кривых указывают на значительные различия между обработками при 20 dpi (t-критерий, α = 0.05). А- оксатиапипролин. B- Бентиаваликарб. C- Зорвец Эндавия. Д- Инфинито. Е- Мефеноксам. F- Площадь под кривой прогрессирования заболевания.

Рис 4. Системная защита картофеля Никола…

Рис 4. Системная защита картофеля Никола от фитофтороза 4-мя фунгицидами, примененными к…


Рис 4.Системная защита картофеля Никола от фитофтороза 4 внесенными в почву фунгицидами.

Шестинедельные полевые растения (левая панель) обрабатывали фунгицидами через почву. Через 21 день после обработки растения инокулировали спорангиальной суспензией Phytophthora infestans . Фотографии зараженных растений (средняя и правая панели) были сделаны с разрешением 13 dpi. ZE, MFX, Infinito и OXPT, все применяются в дозе 50 мг а.и. на 5 растений в контейнере.

Рис. 5.Системная защита картофеля Sifra…

Рис. 5. Системная защита картофеля Сифра от фитофтороза каждым из трех фунгицидов…


Рис. 5. Системная защита картофеля Сифра от фитофтороза каждым из трех внесенных в почву фунгицидов.

Пять 8-недельных растений картофеля, растущих в контейнере емкостью 64 л, обрабатывали однократной обработкой почвы 1-литровой суспензией фунгицида, содержащей 0, 12.5, 25 или 50 мг а.и. фунгицида. Листья (один сложный лист на растение) отделяли через 4–16 дней после обработки, инокулировали Phytophthora infestans в вегетационных камерах и визуально оценивали развитие фитофтороза через 7 дней после инокуляции. Разные буквы на кривых указывают на достоверную разницу между средними значениями (n = 3) при α = 0,05.

Рис. 6.Системная защита картофеля Sifra…

Рис. 6. Системная защита картофеля Сифра от фитофтороза, вызванного устойчивым к MFX изолятом…


Рис. 6. Системная защита картофеля Sifra от фитофтороза, вызванного устойчивым к MFX изолятом Phytophthora infestans , в полевых условиях.

растения картофеля, выращенные в контейнерах емкостью 64 л, обрабатывали пропиткой почвы 12,5, 25 или 50 мг суспензии фунгицида д.в. на контейнер (n = 3). Через 25 дней после обработки растения инокулировали спорангиальной взвесью изолята 164 этого патогена. Процент площади листа, занятой поражением фитофторозом, визуально регистрировали через различные промежутки времени после инокуляции. Различные буквы на кривых указывают на значительные различия между обработками (n = 3) при 21 dpi (t-критерий, α = 0.05). А- оксатиапипролин. B- Бентиаваликарб. C- Зорвец Эндавия. D- Площадь под кривой прогрессирования заболевания.

Рис. 7. Системная защита картофеля Sifra…

Рис. 7. Системная защита картофеля Sifra от фитофтороза, вызванного устойчивым к MFX изолятом…


Рис. 7.Системная защита картофеля Sifra от фитофтороза, вызванного устойчивым к MFX изолятом Phytophthora infestans , в полевых условиях.

растения картофеля, выращенные в контейнерах емкостью 64 л, обрабатывали пропиткой почвы 12,5, 25 или 50 мг суспензии фунгицида д.в. на контейнер (n = 3). Через 25 дней после обработки растения инокулировали спорангиальной взвесью изолята 164 этого патогена. Фотография сделана с разрешением 10 dpi.

Рис. 8.Стойкость фунгицидной активности в…

Рис. 8. Стойкость фунгицидной активности в почве.

Земля в 64-литровых контейнерах была залита водой…


Рис. 8. Стойкость фунгицидной активности в почве.

Почва в 64-литровых контейнерах была пропитана каждым из пяти фунгицидов по 18.11.2019 г. и посев картофеля Никола 01.07.2020 г., через 118 дней после обработки (дата). Приблизительно через 10 недель после посева все растения инокулировали спорангиальной суспензией Phytophthora infestans . За развитием болезни следили в течение 21 дня после инокуляции (139 дней), регистрируя процент зараженной площади листа. А- оксатиапипролин. B- Бентиаваликарб. C- Зорвец Эндавия. D- Мефеноксам и Инфинито. E- Площадь под кривой прогрессирования заболевания. Различные буквы на кривых указывают на значительные различия между обработками (n = 3) при 21 dpi (t-критерий, α = 0.05).

Рис. 9. Стойкость фунгицидной активности в…

Рис. 9. Стойкость фунгицидной активности в почве.

Внешний вид зараженных растений на…


Рис 9.Стойкость фунгицидной активности в почве.

Внешний вид зараженных растений через 10 дней после инокуляции, через 128 дней после пропитки почвы OXPT, BENT или ZE по 25 или 50 мг а.и. на 5 растений в контейнере.

Рис. 10. Сравнение эффективности применения ZE…

Рис. 10.Сравнительная эффективность ZE, применяемого в виде опрыскивания листвы или в виде почвы…


Рис. 10. Сравнительная эффективность ZE, применяемого в виде опрыскивания листвы или пропитки почвы картофелем Sifra в полевых условиях, по сравнению с искусственной инокуляцией Phytophthora infestans .

Десятинедельные растения опрыскивали 40 г а.и./га или обрабатывали почвой из расчета 150 или 500 г а.и./га. Листья отделяли на 10 и 21 сутки после обработки и инокулировали спорангиальной взвесью возбудителя в вегетационных камерах при 20°С.Фотографии сделаны с разрешением 7 dpi.

Все фигурки (10)

Похожие статьи

  • Эффективный контроль двух генотипов Phytophthora infestans в полевых условиях с помощью трех фунгицидных смесей оксатиапипролина.

    Коэн Ю., Рубин А.Е., Гальперин М.Коэн Ю. и соавт.
    ПЛОС Один. 2021 8 октября; 16 (10): e0258280. doi: 10.1371/journal.pone.0258280. Электронная коллекция 2021.
    ПЛОС Один. 2021.

    PMID: 34624036
    Бесплатная статья ЧВК.

  • Обработка корней оксатиапипролином, бентиаваликарбом или их смесью обеспечивает пролонгированную системную защиту от лиственных патогенов оомицетов.

    Коэн Ю.
    Коэн Ю.
    ПЛОС Один. 2020 13 января; 15 (1): e0227556.doi: 10.1371/journal.pone.0227556. Электронная коллекция 2020.
    ПЛОС Один. 2020.

    PMID: 316
    Бесплатная статья ЧВК.

  • Фунгициды на основе оксатиапипролина обеспечивают усиленный контроль над фитофторой томатов, вызванной нечувствительной к мефеноксаму Phytophthora infestans.

    Коэн Ю., Рубин А.Е., Гальперин М.
    Коэн Ю. и соавт.
    ПЛОС Один. 27 сентября 2018 г .; 13 (9): e0204523. doi: 10.1371/журнал.поне.0204523. Электронная коллекция 2018.
    ПЛОС Один. 2018.

    PMID: 30260986
    Бесплатная статья ЧВК.

  • Генетические факторы, кодирующие устойчивость к фитофторозу, вызываемому Phytophthora infestans (Mont.) de Bary, на генетической карте картофеля.

    Сливка Дж.
    Сливка Дж.
    Cell Мол Биол Летт. 2004;9(4В):855-67.
    Cell Мол Биол Летт. 2004.

    PMID: 15647802

    Рассмотрение.

  • Экологичная борьба с возбудителем фитофтороза картофеля и потенциальная роль молочнокислых бактерий: обзор.

    Аксель С., Заннини Э., Коффи А., Го Дж., Уотерс Д.М., Арендт Э.К.
    Аксель С и др.
    Приложение Microbiol Biotechnol. 2012 Октябрь; 96 (1): 37-48. doi: 10.1007/s00253-012-4282-y. Epub 2012 4 августа.
    Приложение Microbiol Biotechnol. 2012.

    PMID: 22864968

    Рассмотрение.

Цитируется

1
артикул

  • Эффективный контроль двух генотипов Phytophthora infestans в полевых условиях с помощью трех фунгицидных смесей оксатиапипролина.

    Коэн Ю., Рубин А.Е., Гальперин М.
    Коэн Ю. и соавт.
    ПЛОС Один. 2021 8 октября; 16 (10): e0258280. doi: 10.1371/journal.pone.0258280. Электронная коллекция 2021.
    ПЛОС Один. 2021.

    PMID: 34624036
    Бесплатная статья ЧВК.

использованная литература

    1. Пастерис Р.Дж., Ханаган М.А., Бисаха Дж.Дж., Финкельштейн Б.Л., Хоффман Л.Е. и др. 2016. Открытие оксатиапипролина, нового фунгицида для оомицетов, нацеленного на белок, связывающий оксистерол. Биорг Мед Хим. 24: 354–361.

      пабмед

    1. Cohen Y. 2015. Новый оомицид оксатиапипролин ингибирует все стадии бесполого жизненного цикла Pseudoperonospora cubensis — возбудителя ложной мучнистой росы тыквенных культур.PLoS ONE 10(10): e0140015 10.1371/journal.pone.0140015

      DOI

      ЧВК

      пабмед

    1. Коэн Ю.2020. Обработка корней оксатиапипролином, бентиаваликарбом или их смесью обеспечивает пролонгированную системную защиту от оомицетов листовых патогенов. PLoS ONE 15(1): e0227556 ​​10.1371/journal.pone.0227556

      DOI

      ЧВК

      пабмед

    1. Коэн Ю., Рубин А.Е. и Гальперин М. 2019. Новые синергические фунгицидные смеси оксатиапипролина защищают семена подсолнечника от ложной мучнистой росы, вызываемой Plasmopara halstedii. PLoS ONE 14(9): e0222827 10.1371/journal.pone.0222827

      DOI

      ЧВК

      пабмед

    1. Коэн Ю., Рубин А.Е. и Гальперин М. 2018а. Фунгициды на основе оксатиапипролина обеспечивают усиленный контроль над фитофторой томатов, вызванной нечувствительной к мефеноксаму Phytophthora infestans. PLoS ONE 13(9): e0204523.

      ЧВК

      пабмед

Показать все 16 ссылок

термины MeSH

  • Устойчивость к болезням / генетика
  • Фунгициды, Промышленность/фармакология
  • Углеводороды, фторированные / введение и дозировка*
  • Углеводороды, фторированные / фармакология*
  • Phytophthora infestans / лекарственные эффекты
  • Phytophthora infestans / патогенность
  • Болезни растений / профилактика и контроль*
  • Корни растений / наркотические эффекты
  • Генетически модифицированные растения / лекарственные эффекты
  • Пиразолы / способ применения и дозы*
  • Пиразолы/фармакология*
  • Solanum tuberosum / микробиология

вещества

  • Углеводороды, Фторированные

Грантовая поддержка

Автор(ы) не получали специального финансирования для этой работы.

границ | BABA-праймированные защитные реакции на Phytophthora infestans у следующего вегетативного потомства картофеля

Введение

Чтобы разработать новые стратегии биотехнологического улучшения иммунитета растений, необходимо усилить способность растений распознавать потенциальных злоумышленников, тем самым усиливая исполнительные реакции устойчивости растений к болезням. Многие ценные генотипы сельскохозяйственных культур обладают низким базальным иммунитетом, как правило, слишком слабым, чтобы эффективно предотвращать болезни.Однако восприимчивые растения могут изменять врожденный иммунитет за счет стимуляции системных защитных реакций. У растений развивается системная приобретенная резистентность (САР) в результате часто слабой и локальной первичной инфекции, вызываемой различными патогенными и непатогенными микроорганизмами, что проявляется в усиленном потенциале формирования иммунных ответов на последующие инфекции (Oostendorp et al., 2001; Prime-A-Plant Group, 2006). Факторы, повышающие врожденный иммунитет сельскохозяйственных культур, включают различные синтетические соединения, известные как индукторы SAR (Conrath, 2011).Эта химическая технология с богатым арсеналом новых синтетических элиситоров может быть успешно применена для долговременной защиты сельскохозяйственных культур от биотических стрессов (Бектас и Эулгем, 2015). Поскольку индукторы SAR могут ограничивать заболеваемость без необходимости быть непосредственно токсичными для растений или патогенных микроорганизмов, они могут быть многообещающими экологически безопасными альтернативами обычным пестицидам.

Физиологическое предварительное кондиционирование для более быстрой и сильной защиты растений после зараженной инокуляции может быть реализовано в стратегии прямых индуцированных ответов или основано на феномене прайминга (Conrath, 2011; Pastor et al., 2013). В отличие от прямо индуцированных гиперергических защитных реакций, прайминг предварительно генерирует изменения в нормергической защите, синхронизированные с потенциальным накоплением информации о предшествующем восприятии (Janus et al., 2013). Отпечаток стресса обычно состоит из биохимических и эпигенетических изменений (Bruce et al., 2007). Вышеупомянутые метаболические адаптации к новым условиям окружающей среды не относятся к изменениям последовательностей ДНК, а состоят из обратимых различными ферментами модификаций ДНК- и гистоновых белков, влияющих на контроль активности транскрипции генов (Zhang, 2008; ван ден Бург и Таккен, 2009 г.; Фу и Донг, 2013 г.).

Важный прорыв в наших знаниях о долговременной метаболической памяти после стресса у растений был сделан в 2012 г., когда три независимые исследовательские группы, т. е. Luna et al. (2012), Питерс (2012), Расманн и др. (2012) и Слотер и соавт. (2012) выявили доказательства межпоколенческого наследования SAR у растений в зависимости от биотических факторов. Индукция защиты растений — очень сложное явление, поскольку конечный результат зависит от эффективности индуктора SAR, защитной реакции растения и условий окружающей среды.

Общепризнано, что β-аминомасляная кислота (ВАМК), небелковая аминокислота, является мощным инициирующим агентом SAR у растений. Высокая эффективность индуктора ВАВА в повышении устойчивости была документирована во многих других системах патоген-растение, включая также систему картофель- Phytophthora infestans (Cohen, 2002; Baider and Cohen, 2003; Si-Ammour et al., 2003; Ton and Mauch-Mani, 2004; Hamiduzzaman et al., 2005; Ton et al., 2005; Andreu et al., 2006; Dubreuil-Maurizi et al., 2010; Уорролл и др., 2012; Янус и др., 2013).

Картофель ( Solanum tuberosum L.) является четвертой наиболее часто выращиваемой сельскохозяйственной культурой в мире и третьей культурой после пшеницы и риса по важности для потребления человеком (Haverkort et al., 2009). В свою очередь, фитофтороз картофеля, вызываемый оомицетом P. infestans (Mont.) de Bary, является одним из самых разрушительных заболеваний растений во всем мире. Потери, вызванные P. infestans , оцениваются примерно в 16% годового мирового производства картофеля (5 евро.2 млрд в год) и затраты на защиту от фитофтороза также исчисляются миллионами долларов. В настоящее время борьба с фитофторозом основана на использовании фунгицидов, которые, помимо экономических потерь, оказывают негативное воздействие на окружающую среду. Сорта Russet Burbank из США и Bintje из Нидерландов, возраст которых превышает 100 лет, до сих пор широко выращиваются из-за их превосходного качества и использования химикатов для борьбы с фитофторозом (Haverkort et al., 2009).В связи с этим новые стратегии биотехнологического улучшения иммунитета растений с использованием индукторов САР могут дать новые агрохимикаты для защиты сельскохозяйственных культур от болезней.

В наших предыдущих работах было выявлено, что среди различных протестированных индукторов САР только ВАМК оказалась эффективным фактором, стимулирующим аппозицию каллозы и повышающим системную устойчивость к патогену у сорта картофеля (‘Bintje’), восприимчивого к P. infestans ( Флоришак-Вечорек и др., 2012; Янус и др., 2013).

В свою очередь, в представленном исследовании мы сосредоточились на системной устойчивости, примированной ВАВА, у того же и следующего вегетативного потомства сорта картофеля, восприимчивого к P. infestans . Мы обнаружили, что праймированный картофель в краткосрочный (3 сут) и длительный (28 сут) периоды времени после индукции и его вегетативные потомки праймированных растений, полученных из клубней после контрольного заражения оомицетом-патогеном, проявлял более быструю и сильную активность. Накопление транскрипта PR1 и ограничение развития фитофтороза.

Материалы и методы

Экспериментальный проект для создания потомственных линий

растения обрабатывали различными концентрациями БАБК, как указано ниже. Иммунизацию проводили путем опрыскивания листьев картофеля подобранной дозой БАБК (3 мл на растение) на стадии 7–8 листьев родительских растений (В 0 ). Некоторые растения, сенсибилизированные ВАВА, инокулировали суспензией зооспор P. infestans для оценки уровня их иммунизации и прогрессирования заболевания.Отдельную партию растений выращивали до фазы цветения (В 0 1 ; около 28 дней), а затем подвергали воздействию болезни. Фракцию растений В 0 1 использовали в качестве исходного материала для получения вегетативного потомства, происходящего от ВАВА-сенсибилизированного родительского образца. Потомство индуцированных растений было получено путем размножения in vitro и in vivo , т. е. из боковых почек, размноженных от проростков in vitro (B A ) и через клубни (B B ) соответственно.Затем эти растения культивировали до стадии 7–8 листьев, а затем инокулировали зооспорами оомицета. Параллельную линию неиндуцированных контрольных растений сохраняли и позже подвергали биотическому стрессу, чтобы обеспечить всестороннее сравнение обработанных ВАВА и неиндуцированных растений (C 0 , C 0 / C 1 , C A и С В ). Растительный материал собирали для анализа при 24 л.с. Растения, подвергшиеся воздействию 1 мМ дозы БАБК, анализировали при 1, 3, 6 и 24 HPI.Схема экспериментального плана, использованного в представленной статье, представлена ​​на рисунке 1.

РИСУНОК 1. Схема эксперимента по созданию линий потомства. C 0 – контрольное растение в фазе вегетации, B 0 – растения, иммунизированные различными дозами БАБК в фазе вегетации, C 0 /C 1 – контрольные растения в фазе цветения, B 0 / В 1 – образец в стадии цветения, ранее снабженный БАБК в фазе В 0 , С А – партия здоровых растений, происходящих от неиндуцированных родителей С 0 , полученных из боковых почек, размноженных через in vitro проростки от родительской линии, обработанной ВАВА, С В – регенерированные из клубней, В А – линия растений, полученная микроразмножением in vitro ВАВА-праймированных родителей (в фазе В 0 ), В В – регенерированные из клубней B 0 .

Растительный материал

Восприимчивый сорт картофеля S. tuberosum L. ‘Bintje’ из Генбанка картофеля (Институт селекции и акклиматизации растений – IHAR-PIB в Бонине) был первоначально получен из культуры ткани in vitro и хранился в стерильной почве в фитокамере. (16 ч/8 ч: день/ночь; 180 мкмоль м -2 с -1 ) при 18 ± 1°C и относительной влажности 60%.

Культура патогенов и инокуляция

P. infestans

Phytophthora infestans (Mont.) de Bary, вирулентный для ‘Bintje’ (1.3.4.7.10.11., изолят MP946), был любезно получен из Научно-исследовательского отдела Института селекции и акклиматизации растений в Млохове, Польша. Растения картофеля инокулировали опрыскиванием листьев 5 мл взвеси зооспор оомицетов в концентрации 1,0 х 10 5 на 1 мл воды и выдерживали в течение ночи при 100% относительной влажности и 18°С, после чего переносили в камера роста.

Иммунизация различными дозами ВАВА

Чувствительный к картофелю генотип ‘Bintje’ был иммунизирован путем опрыскивания листьев картофеля выбранной дозой ВАВА (3 мл на растение; Floryszak-Wieczorek et al., 2012). Концентрации БАБК, используемые в эксперименте, были следующими: 0,1, 1, 10 и 20 мМ, и их доставляли на поверхность растений с помощью распылителя.

Оценка индекса заболеваемости

Площадь, пораженную симптомами болезни, оценивали на листьях картофеля через 3–7 дней после инокуляции P. infestans по шкале от I до IV (James, 1971), которая представляет собой процент площади листа, покрытой симптомами фитофтороза. (I = 1–9 %; II = 10–24 %; III = 25–49 %; IV = 50–100 %).Симптомы заболевания также определяли с помощью окрашивания трипановым синим мицелия P. infestans по методу, предложенному Wilson and Coffey (1980).

Измерение экспрессии генов

РНК выделяли из 150 мг замороженной ткани листа с использованием TriReagent ® (Sigma) по методу Chomczynski and Sacchi (1987). Полученную РНК очищали с использованием набора дезоксирибонуклеазы I (Sigma). Для обратной транскрипции 1 мкл РНК из каждого экспериментального варианта обрабатывали набором RevertAid TM Reverse Transcriptase Kit (Thermo Scientific) в соответствии с инструкциями производителя.ПЦР в реальном времени проводили на термоциклере Rotor Gene 6000 (Corbett Life Sciences). Реакционная смесь содержала 0,1 мкМ каждого праймера, 1 мкл 5-кратно разведенной кДНК, 10 мкл Power SYBR ® Green PCR Master mix (Applied Biosystems) и воду, обработанную DEPC, до общего объема 20 мкл. Условия ПЦР в реальном времени включали начальную 5-минутную денатурацию при 95°С, за которой следовали 55 циклов, состоящих из 10 с при 95°С, 20 с при 53°С и 30 с при 72°С. Реакцию завершали денатурацией при повышении температуры от 72 до 95°С со скоростью 1° за 5 с.Специфичность реакции подтверждали наличием одного пика при анализе кривой плавления.

PR-1 Праймеры, использованные для обнаружения в реальном времени, были следующими:

F: CGCCGTTGAGCTGGGGGAAA, R: GAGCTGGGGACTGCAGGATGC ( T m = 53°C). Данные нормированы на референсные гены, кодирующие фактор элонгации (ef1α, AB061263; F: ATTGGAAACGGATATGCTCCA, R: TCCTTACCTGAACGCCTGTCA, T m = 53°C) и 18S рРНК (X67238.1, F: GGGCATTCAGGTATTTC:GTCTCA). GGTTCTTGATTAATGAAAACATCCT).Все использованные праймеры были разработаны с помощью Primer-BLAST (Ye et al., 2012). Значения C t были определены с использованием ПЦР в реальном времени Miner (Zhao and Fernald, 2005), а относительная экспрессия генов была рассчитана с использованием расчетных моделей с поправкой на эффективность, представленных Pfaff (2004).

Статистический анализ

Все результаты основаны как минимум на трех независимых экспериментах, в каждом из которых было не менее трех биологических повторов. Был проведен дисперсионный анализ, и наименее значимые различия (LSD) между средними были определены с использованием критерия Тьюки при уровне значимости P = 0.05. Программное обеспечение SigmaPlot 11.0 (Systat) использовалось для проведения статистических тестов. Рандомизацию проводили при сборе образцов в гистохимическом анализе окрашивания трипановым синим.

Результаты

В соответствии со схемой эксперимента, представленной на рис. 1, анализировали транскрипт накопления гена PR1 в системных листьях ВАВА-праймированных растений картофеля в короткий (3 сут) и длительный (28 сут) периоды времени после индукции и последующего , в вегетативном потомстве праймированных растений, полученных из клубней и боковых почек, через проростков in vitro .Перечисленные варианты индуцированных растений впоследствии инокулировали P. infestans. Все наблюдаемые изменения относили к контролю – растениям картофеля, не подвергавшимся праймированию или инокулированным только вирулентным патогеном. Кроме того, эффективность примененного индуктора или прайминга в приобретении системной устойчивости у растений картофеля и в анализе наследования этого признака оценивали на основе анализа индекса болезни, т.е. развития симптомов фитофтороза картофеля.

PR-1 Экспрессия генов в BABA-праймированных родительских растениях картофеля (B 0 )

Влияние различных концентраций ВАВА на накопление транскриптов PR1 анализировали через 3 дня после обработки растения (B 0 ; фигура 2A). В целом уровень транскриптов PR1 не повышался в растениях, подвергшихся воздействию БАМК, за исключением небольшого повышения в случае дозы индуктора 10 мМ. Напротив, растения, сенсибилизированные ВАВА, а затем инокулированные с контрольным заражением, демонстрировали сильное повышение уровня экспрессии PR1 от двух до семи раз, в зависимости от используемой концентрации ВАВА (рис. 2В).Защиту примированных растений картофеля от P. infestans оценивали через 7 дней после инокуляции (рис. 2С). Индекс развития болезни в листьях картофеля представляет собой процент площади листа, покрытой симптомами фитофтороза, классифицируемый по четырем категориям в зависимости от степени колонизации ткани листа патогеном (рис. 2D). Все применяемые концентрации БАБК проявляли защитный эффект с точки зрения ограничения болезни по сравнению с необработанными растениями. Поскольку иммунитет, вызванный 1 мМ ВАВА, также был эффективен для защиты растений, в результате прибл.Сокращение пятен болезни на 80%, мы сосредоточились на этой дозе ВАВА при анализе уровней транскриптов PR1 в разные моменты времени после инокуляции контрольного заражения. Обеспокоенность заключалась в том, что самые высокие концентрации ВАВА (10 и 20 мМ) могут вызывать гиперергические защитные эффекты или передаваться следующему поколению.

РИСУНОК 2. PR-1 накопление транскриптов генов и дозозависимая защита БАБК от Phytophthora infestans в листьях картофеля (B 0 (A) PR-1 Накопление транскриптов гена через 3 дня после индукции ВАВА (левые столбцы) и через 24 ч после инокуляции ранее индуцированных растений (правые столбцы), (B) временной анализ PR -1 экспрессия гена в P. infestans -инокулированные растения, предварительно обработанные 1 мМ дозой ВАВА (на стадии B 0 ), (C) индекс развития болезни при 7 dpi у родителей, непосредственно обработанных ВАВА В 0 , (Г) шкала, соответствующая площади листьев, пораженных фитофторозом, и окраске трипановым синим Р.мицелий infestans . Достоверно отличается от контрольных листьев, P < 0,05. Значения представляют собой средние значения данных ± стандартное отклонение по крайней мере трех независимых экспериментов, каждый из которых имеет по крайней мере три биологических повтора.

Таким образом, мы обнаружили, что временная динамика экспрессии мРНК PR1 в листьях картофеля, обработанных 1 мМ ВАВА, а затем инокулированных, показала в 10 раз более высокий уровень экспрессии, достигая максимума при 6 и 24 hpi по сравнению с непримированными и инокулированными растениями (рис. 2Б).

PR-1 Экспрессия генов в BABA-примированном родительском картофеле после его перехода в генеративную стадию (B 0 /B 1 )

Чтобы подтвердить, что прайминг не меняется после образования цветочных почек растениями картофеля, мы провели эксперименты в течение более длительного периода времени после обработки родительских растений ВАВА. Несколько более интенсивный уровень экспрессии PR1 (в диапазоне от 1,2 до 2,2), коррелирующий с повышенными концентрациями БАМК, был обнаружен в листьях картофеля через 28 дней (рис. 3А) по сравнению с 3-м днем ​​после обработки (рис. 2А).В свою очередь, BABA-опосредованный транскрипт мРНК для PR1 быстро активировался после инокуляции контрольного заражения и, что интересно, был самым повышенным (10-удержание выше) у растений, снабженных 1 мМ BABA (рис. 3A). Независимый анализ временных паттернов экспрессии PR1 показал, что растения картофеля, предварительно обработанные 1 мМ ВАВА, демонстрировали более раннюю экспрессию (начиная с 1 hpi) и более высокую степень транскрипции (до 24 hpi), чем непримированные растения (рис. 3B). Кроме того, BABA-примированные растения картофеля B 0 / B 1 показали повышенную устойчивость к P.infestans по сравнению с C 0 /C 1 (рис. 3C). Растения из этого потомства, предварительно обработанные 1 мМ ВАВА, демонстрировали почти 70% снижение симптомов фитофтороза.

Рисунок 3. PR-1 Накопление ген-транскрипта и баба, зависимая доза защита от P. Infestans на цветении (B 0 / B 1 ) родительских растений, обработанных БАБК.(A) Накопление транскриптов гена PR-1 через 28 дней после индукции ВАВА (левые столбцы) и после инокуляции ранее иммунизированных растений (при 24 HPI; правые столбцы), (B) анализ в зависимости от времени Экспрессия гена PR-1 в растениях P. infestans , предварительно обработанных 1 мМ дозой ВАВА (за 28 дней до этого). (C) индекс развития болезни при 7 днях на дюйм у родителей, получавших ВАВА, на стадии цветения (B 0 / B 1 ). Достоверно отличается от контрольных листьев, P < 0,05. Значения представляют собой средние значения данных ± стандартное отклонение по крайней мере трех независимых экспериментов, каждый из которых имеет по крайней мере три биологических повтора.

Стенограмма накопления

PR1 в вегетативном потомстве BABA-праймированных растений, полученных из клубней (B B )

Для изучения устойчивости стрессовой памяти в случае приобретенной устойчивости мы проанализировали потомство картофеля, выращенное из клубней, полученных от праймированных растений (линия В В ).Полученные данные выявили сходную тенденцию активации генов PR1 и иммунитета, что и у родительских растений, примированных ВАВА. Таким образом, вегетативное потомство, полученное из клубней картофеля, показало слабую экспрессию PR1 перед инокуляцией и усиленную индукцию PR1 при сильном заражении патогеном оомицета (фиг. 4А). Анализ потомства растений, примированных 1 мМ ВАВА, выявил длительное влияние на зависящую от времени кинетику экспрессии гена PR1 , усиленную при 6 и 24 hpi (рис. 4B).Кроме того, было документально подтверждено, что примированное потомство индуцированных растений сохраняло приобретенную системную устойчивость к P. infestans в виде прибл. Площадь пятна болезни уменьшилась на 60% по сравнению с зараженными листьями без грунтовки (рис. 4С).

РИСУНОК 4. PR-1 Накопление транскриптов генов в линиях потомства иммунизированных растений картофеля (стадия В В ) — потомство, полученное от обработанной ВАВА родительской линии с использованием клубней.(A) После индукции растений, происходящих из B 0 , с помощью ВАВА (левые столбцы) и через 24 часа после инокуляции ранее иммунизированных растений (правые столбцы), (B) временной анализ PR-1 экспрессия генов в растениях, инокулированных P. infestans , полученных из клубней растений, подвергшихся воздействию 1 мМ БАБК (на стадии В 0 ), (С) индекс развития болезни при 7 dpi в обработанной БАМК родительской линии с использование клубней, достоверно отличается от контрольных листьев, P < 0.05. Значения представляют собой средние значения данных ± стандартное отклонение по крайней мере трех независимых экспериментов, каждый из которых имеет по крайней мере три биологических повтора.

Расшифровка Накопление

PR1 в вегетативном потомстве BABA-праймированных растений, полученных из боковых почек, размноженных с помощью сеянцев in Vitro (B A )

Вегетативное потомство индуцированных растений картофеля с помощью культуры in vitro показало сенсибилизацию к праймированию PR1 , запускаемому ВАВА, и, таким образом, создало активацию импринта стресса, способствуя приобретению способности реагировать быстрее после инокуляции.Это отражалось в минимальном повышении уровней PR1 перед инфекцией и усиленной индукции экспрессии гена при обработке патогеном (рис. 5А). Вегетативное потомство 1 мМ BABA-праймированных растений, полученных из боковых почек (рис. 5B), демонстрировало сравнимую кинетику и немного меньшую интенсивность накопления транскриптов PR1 , чем потомство праймированных потомков, выращенных из клубней, в последующие 24 часа после инокуляции заражения (рис. 4B). .

РИСУНОК 5. PR-1 накопление транскриптов генов в потомственных линиях иммунизированных растений картофеля (B A ) – потомство, полученное от обработанной ВАВА родительской линии с использованием растений, полученных из боковых почек, размноженных от в vitro саженцы. (A) После индукции растений, происходящих из B 0 , с помощью ВАВА (левые столбцы) и через 24 часа после инокуляции ранее иммунизированных растений (правые столбцы), (B) временной анализ PR-1 экспрессия гена в P.infestans — инокулированные растения, полученные от родителей, сенсибилизированных 1 мМ ВАВА (на стадии B 0 ). (C) Индекс развития болезни на 7 dpi в обработанной ВАВА родительской линии с использованием растений, полученных из боковых почек, размноженных от сеянцев in vitro , достоверно отличается от контрольных листьев, P < 0,05. Значения представляют собой средние значения данных ± стандартное отклонение по крайней мере трех независимых экспериментов, каждый из которых имеет по крайней мере три биологических повтора.

Таким образом, праймированное состояние восприимчивого сорта картофеля (сорт Bintje) было передано его вегетативному потомству в виде потенцированной экспрессии гена PR1 после инокуляции контрольного заражения. Тем не менее, растения картофеля из культуры in vitro в значительной степени утратили признак приобретенной устойчивости к P. infestans , и площадь листа, пораженная фитофторозом, была аналогична таковой у зараженного контроля (рис. 5С).

Обсуждение

Результаты последовательной обработки растений картофеля ВАВА с последующим введением вирулентного штамма P.infestans при контрольном заражении предоставил данные об отпечатке постстрессорной информации и ее длительном сохранении до оплодотворения в виде усиленного накопления транскриптов PR1 и временного улучшения приобретенной устойчивости к фитофторозу.

Очень важный вопрос в оценке эффективности SAR связан с правильным подбором информативных маркеров признака, приобретенного растением и потенциально усиленного или наследуемого.В целом известно, что возникновение SAR тесно связано с системной активацией связанных с патогенезом ( PR ) генов, кодирующих защитные белки растений (Ryals et al., 1996). Появляется все больше свидетельств того, что среди различных генов PR ген PR1 наиболее чувствителен к праймингу в индуцированно-родительском растении и его потомстве (Luna and Ton, 2012; Luna et al., 2014b). При подготовке к защите ключевой вопрос заключается в том, что экспрессия гена PR1 как хороший отпечаток ВАВА-индуцированного в основном включается после инокуляции заражения.Наши результаты показали, что как растения картофеля, подвергшиеся непосредственному воздействию БАБК (В 0 и В 0 1 ), так и их вегетативные потомства (В А и В В ) были сенсибилизированы к праймированию 3 PR1 9163. , таким образом, они демонстрировали стрессовую память о предыдущих обработках, которым подвергались их родительские растения. Важно отметить, что предварительная обработка ВАВА индуцировала либо минимальную, либо не индуцировала экспрессию гена PR1 , но метаболическая память обработки должна была сохраняться и появлялась как следствие атаки патогена.Следовательно, временное повышение уровня транскриптов PR1 было выявлено только тогда, когда растение подвергалось контрольному заражению P. infestans в картофеле, примированном тем же поколением, и в его следующем вегетативном потомстве.

Анализируя долгую историю исследований SAR у растений, необходимо подчеркнуть, что исследовательские гипотезы, предложенные в отношении этой проблемы, помимо сторонников, также подвергались сомнению многими противниками (Heidel et al., 2004; Walters and Heil, 2007).Часто цитируемый аргумент против SAR был связан с оговоркой о снижении урожайности и вариации реакции растений на защитные элиситоры, вызванной генотипом и окружающей средой (Bruce, 2014). Также было подчеркнуто, что приобретенная устойчивость сменяется при вступлении растений в репродуктивную фазу из-за измененного баланса фитогормонов (Molinier et al., 2006; Pecinka, Scheid, 2012; Banday, Nandi, 2015). Поэтому эффективность праймирования БАБК была проанализирована нами на растениях картофеля в состоянии цветения.Полученные данные показали, что память о сенсибилизации должна сохраняться у растений картофеля, так как в присутствии патогена уровень PR1 повышался (10-удержание) через 28 дней после обработки БАБК.

Якаб и др. (2001) на Arabidopsis thaliana показали, что ВАВА, применяемая в виде опрыскивания листвы, в отличие от пропитки почвы, даже при низких концентрациях усиливала накопление мРНК PR1 . Более того, оба экспериментальных подхода приводили к индукции устойчивости, предполагая, что в этом случае установление устойчивости может быть независимым от экспрессии PR1 .Вообще говоря, накопление PR1 сильно зависит от генотипа растения и может значительно изменяться в контролируемых условиях фитокамеры по сравнению с неконтролируемыми условиями в теплице или в поле (Cohen et al., 1994; Cohen, 2002). Следовательно, разные механизмы защиты эффективны против разных патогенов, и ВАВА может стимулировать растение к организации таких специфичных для патогенов реакций гораздо быстрее (Zimmerli et al., 2000).

Для изучения передачи эффектов ВАВА-праймирования на вегетативное потомство картофеля мы наблюдали персистентное состояние прайминга в виде усиленной экспрессии PR1 и замедления развития симптомов фитофтороза на листьях растения, полученного из клубней.Таким образом, мы обнаружили, что праймированное состояние у сенсибилизированного картофеля сорта. Bintje сохранялся в течение одного поколения и передавался потомкам посредством митотических делений. Поскольку сорта картофеля, как правило, гораздо более устойчивые к P. infestans , в промышленных масштабах размножаются клубнями, полученные данные могут иметь большое практическое значение. Фитофтороз в поле может развиваться очень быстро и уничтожать листву картофеля за очень короткое время при благоприятных погодных условиях, вызывая ежегодные убытки от нескольких до нескольких миллиардов долларов во всем мире (Schepers et al., 2009; Ху и др., 2012). Устойчивость, примированная ВАВА, может предоставить новые инструменты для улучшения защиты урожая благодаря повышенной естественной способности растений картофеля к защите от P. infestans или сокращению использования фунгицидов (Liljeroth et al., 2010).

Эффективность ВАВА для индуцирования устойчивости к P. infestans изучалась Olivieri et al. (2009) у сортов картофеля, различающихся по степени устойчивости к фитофторозу. Полученные клубни от растений, обработанных ВАВА, заражены контрольным заражением P.infestans , показали гораздо более выраженное повышение уровней фенола и фитоалексина в устойчивых (сорт Pampeana), а не в восприимчивых (сорт Bintje) растениях картофеля по сравнению с необработанными. Аналогичным образом, у обоих вышеупомянутых сортов картофеля предварительная обработка ВАВА повысила урожайность собранных клубней. Сортозависимые различия в реакции на применение ВАВА также изучались Бенгтссоном и соавт. (2014). Результаты подтвердили предыдущие данные (Olivieri et al., 2009) о том, что обработка БАБК повышает устойчивость картофеля, хотя эффективность подачи БАБК различается между сортами картофеля.Таким образом, в более устойчивом сорте. Онтарио, как значительное снижение роста P. infestans , так и активация различных защитных реакций были быстрее и сильнее, чем у cv. Бинтье (Bengtsson et al., 2014). Однако, по мнению этих авторов, наблюдаемые изменения следует отнести скорее к прямым защитным реакциям картофеля, чем к праймированным.

Наши результаты демонстрируют, что состояние праймирования для защиты восприимчивого сорта картофеля (сорт Bintje) передается его вегетативному потомству в виде усиленного накопления мРНК PR1 после дальнейшего заражения P.infestans с защитой от поражения патогенами в растениях, полученных из клубней. Несмотря на сходство в транскрипционном ответе PR1 , растения, полученные из боковых почек, размноженных через проростки in vitro , показали меньший потенциал для включения эффективных путей защиты от патогена оомицетов. Как правило, каждый BABA-праймированный генотип, включая cv. Bintje обладает способностью мобилизовать постстрессорные реакции через SA-зависимые и/или JA/этилен-зависимые регуляторные пути в пределах собственного порога защиты, чтобы противостоять следующей инфекции.Относительно низкая базальная устойчивость восприимчивого сорта. Bintje было недостаточно для эффективной защиты растений следующего примированного потомства от in vitro от патогена оомицета. Помимо экспрессии гена PR1 , проанализированной в нашем эксперименте, праймирование приводит к усиленной активации мультигенных защитных механизмов (Ahmad et al., 2010). Не исключено, что воздействие на растения в условиях in vitro может повлиять на восприимчивость проростков картофеля.

Согласно Брюсу (2014), индуцированная защита растений представляет собой сложное явление, и его высокая изменчивость зависит от генетики и физиологии растений, а также может быть изменена условиями окружающей среды. Более того, эксперименты, проведенные на 32 образцах томатов с использованием ВАВА, показали, что защита индуцированных растений против P. infestans не была идентичной на образцах, проявляющих тот же уровень чувствительности, и как положение листа, так и изолят взаимодействовали с индуцируемостью (Sharma et al., 2009). В следующем экспериментальном подходе они подтвердили предыдущее утверждение о том, что уровень индуцированной защиты не всегда был связан с уровнем устойчивости образца томата, и на него значительно влиял изолят патогена, используемый для инокуляции контрольного заражения (Sharma et al., 2010). Таким образом, понимание молекулярной основы прайминга для защиты становится абсолютно необходимым и будет значительно способствовать повышению базальной устойчивости растений без отрицательных или скомпрометированных эффектов.

Еще одна существенная проблема применения БАБК в качестве активатора защиты растений связана с ингибированием роста растений при использовании в высоких дозах (van Hulten et al., 2006; Walters, Heil, 2007). Недавние исследования Luna et al. (2014a) показали, что клеточное восприятие ВАВА опосредуется аспартил-тРНКсинтетазой (AspRS), кодируемой геном IMPAIRED IN BABA-INDUCED IMMUNITY 1 ( INB1 ). Они задокументировали функционирование двух отдельных регуляторных путей, управляемых IBI1 , с использованием A.thaliana с нарушением иммунитета к ВАВА-индуцированному заболеванию ( ibi1 ), но который был гиперчувствительным к ВАВА-индуцированной репрессии роста. По мнению авторов, глубокое выяснение этих независимых молекулярных механизмов открывает новые возможности для создания конститутивно праймированных растений без обработки ВАВА и ингибирования роста (Schwarzenbacher et al., 2014).

Концепция эпигенетического контроля защитной подготовки была в целом принята многими исследовательскими группами; однако потребуется больше подробностей об этом явлении (van den Burg and Takken, 2009; Luna and Ton, 2012; Luna et al., 2014б). В нашем экспериментальном подходе мы исходили из того, что получение последовательных вегетативных поколений высоковосприимчивого сорта картофеля с состоянием повышенной готовности в виде усиленной экспрессии PR1 по отношению к вирулентному P. infestans дает отправную точку для идентификации молекулярных переносчиков такая унаследованная постстрессовая информация. Интересно также будет узнать, где лежит функциональная связь между состоянием готовности и исполнительным состоянием иммунитета растений.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Подтверждение

Это исследование финансировалось Национальным научным центром (2013/11/B/NZ9/01903).

Ссылки

Ахмад, С., Гордон-Уикс, Р., Пикетт, Дж., и Тон, Дж. (2010). Естественные вариации в затравке базальной резистентности: от эволюционного происхождения до сельскохозяйственной эксплуатации. Мол. Завод Патол. 11, 817–827. doi: 10.1111/j.1364-3703.2010.00645.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Андреу, А.Б., Гевара, М.Г., Вольский, Э.А., Далео, Г.Р., и Калдиз, Д.О. (2006). Повышение естественной устойчивости картофеля к болезням химическими препаратами. Борьба с вредителями науч. 62, 162–170. doi: 10.1002/ps.1142

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Байдер, А., и Коэн, Ю. (2003).Синергическое взаимодействие между ВАВА и манкоцебом в борьбе с Phytophthora infestans на картофеле и томате и Pseudoperonospora cubensis на огурце. Phytoparasitica 31, 399–409. дои: 10.1007/BF02979812

Полнотекстовая перекрестная ссылка | Академия Google

Бандай, З.З., и Нанди, А.К. (2015). Взаимосвязь между контролем времени цветения и активацией системной приобретенной устойчивости. Фронт. Растениевод. 6:174. doi: 10.3389/fpls.2015.00174

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бенгтссон, Т., Holefors, A., Witzell, J., Andreasson, E., и Liljeroth, E. (2014). Активация защитных реакций на Phytophthora infestans у картофеля с помощью ВАВА. Завод Патол. 63, 193–202. doi: 10.1111/ppa.12069

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Брюс, Т. Дж. А., Маттес, М. К., Напье, Дж. А., и Пикетт, Дж. А. (2007). Стрессовые «воспоминания» растений: доказательства и возможные механизмы. Растениевод. 173, 603–608. doi: 10.1016/j.растенияci.2007.09.002

Полнотекстовая перекрестная ссылка | Академия Google

Хомчински П. и Сакки Н. (1987). Одноэтапный метод выделения РНК кислотной экстракцией ханидинийтиоцианат-фенол-хлороформ. Анал. Биохим. 162, 156–159. doi: 10.1006/abio.1987.9999

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Коэн, Ю. Р. (2002). Индуцированная β-аминомасляной кислотой устойчивость к фитопатогенам. Завод Дис. 86, 448–457.doi: 10.1094/PDIS.2002.86.5.448

Полнотекстовая перекрестная ссылка | Академия Google

Коэн, Ю. Р., Нидерман, Т., Мосингер, Э., и Флухр, Р. (1994). β-Аминомасляная кислота Вызывает накопление белков, связанных с патогенезом, в растениях томатов (Lycopersicon Esculentum L.) и устойчивость к фитофторозу, вызванному Phytophthora infestans . Завод физиол. 104, 59–66.

Академия Google

Дюбрей-Моурици, К., Трувело, С., Фреттингер, П., Пугин А., Вендехенне Д. и Пуанссо Б. (2010). β-Аминомасляная кислота стимулирует выработку активных форм кислорода, зависимую от НАДФН-оксидазы, во время иммунитета, запускаемого виноградной лозой. Мол. Взаимодействие растительных микробов. 23, 1012–1021. doi: 10.1094/MPMI-23-8-1012

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Флоришак-Вечорек, Дж., Арасимович-Елонек, М., Мильчарек, Г., Янус, Л., Павляк-Спрада, С., Абрамовски, Д., и соавт. (2012). Отпечаток стресса, опосредованный оксидом азота, у картофеля как эффект воздействия затравочного агента. Мол. Растение. Взаимодействие микробов. 25, 1469–1477. doi: 10.1094/MPMI-02-12-0044-R

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фу, З. К., и Донг, X. (2013). Системная приобретенная резистентность: превращение локальной инфекции в глобальную защиту. Энн. Преподобный завод биол. 64, 839–863. doi: 10.1146/annurev-arplant-042811-105606

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хамидуццаман, М. М., Якаб, Г., Барнавон, Л., Нейхаус, Дж.-М., и Маух-Мани, Б. (2005). Устойчивость виноградной лозы к ложной мучнистой росе, индуцированная β-аминомасляной кислотой, действует за счет потенцирования образования каллозы и передачи сигналов жасмоновой кислотой. Мол. Взаимодействие растительных микробов. 18, 819–829. doi: 10.1094/MPMI-18-0819

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хаверкорт, А. Дж., Струик, П. К., Виссер, Р. Г. Ф., и Якобсен, Э. (2009). Прикладная биотехнология для борьбы с фитофторозом картофеля, вызываемым Phytophthora infestans . Картофель Рез. 52, 249–264. doi: 10.1007/s11540-009-9136-3

Полнотекстовая перекрестная ссылка | Академия Google

Heidel, A.J., Clarke, J., Antonovics, J., and Dong, X. (2004). Стоимость приспособленности мутаций, влияющих на путь системной приобретенной устойчивости у Arabidopsis thaliana . Генетика 168, 2197–2206. doi: 10.1534/genetics.104.032193

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ху, К.-Х., Перес, Ф.Г., Донаху, Р., McLeod, A., Myers, K., Ivors, K., et al. (2012). Последние генотипы Phytophthora infestans на востоке США обнаруживают клональные популяции и повторное появление чувствительности к мефеноксаму. Завод Дис. 96, 1323–1330. doi: 10.1094/PDIS-03-11-0156-RE

Полнотекстовая перекрестная ссылка | Академия Google

Jakab, G., Cottier, V., Toquin, V., Rigoli, G., Zimmerli, L., Metraux, J.P., et al. (2001). Устойчивость растений к β-аминомасляной кислоте. евро. Дж.Завод Патол. 107, 29–37. дои: 10.1023/A:1008730721037

Полнотекстовая перекрестная ссылка | Академия Google

Джеймс, WC (1971). Иллюстрированная серия ключей оценки болезней растений, их подготовка и использование. Кан. Завод Дис. Surv. 51, 39–65.

Академия Google

Янус, Л., Мильчарек, Г., Арасимович-Елонек, М., Абрамовский, Д., Биллерт, Х., и Флоришак-Вечорек, Дж. (2013). Нормоэргические NO-зависимые изменения, запускаемые индуктором SAR в картофеле, создают более мощные защитные реакции на Phytophthora infestans . Растениевод. 211, 23–34. doi: 10.1016/j.plantsci.2013.06.007

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Лильерот, Э., Бенгтссон, Т., Вийк, Л., и Андреассон, Э. (2010). Индуцированная устойчивость картофеля к Phytphthora infestans-воздействию БАБК в тепличных и полевых испытаниях с различными сортами картофеля. евро. Дж. Плант Патол. 127, 171–183. doi: 10.1007/s10658-010-9599-8

Полнотекстовая перекрестная ссылка | Академия Google

Луна, Э., Брюс, Т.Дж.А., Робертс, М.Р., Флорс, В., и Тон, Дж. (2012). Системная приобретенная резистентность следующего поколения. Завод физиол. 158, 844–853. doi: 10.1104/стр.111.187468

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Луна Э., ван Хультен М., Чжан Ю., Берковиц О., Лопес А., Петриак П. и др. (2014а). Восприятие растениями β-аминомасляной кислоты опосредуется аспартил-тРНК-синтетазой. Нац. хим. биол. 10, 450–456. doi: 10.1038/nchembio.1520

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Луна, Э., Лопес, А., Коойман, Дж., и Тон, Дж. (2014b). Роль NPR1 и KYP в длительной резистентности, индуцированной β-аминомасляной кислотой. Фронт. Растениевод. 5:184. doi: 10.3389/fpls.2014.00184

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Оливьери, Ф.П., Лобато, М.С., Гонсалес Альтамиранда, Э., Далео, Г.Р., Уарте, М., Гевара, М.Г., и соавт. (2009). Влияние БАБА на поведение сортов картофеля, зараженных Phytophthora infestans и Fusarium solani . евро. Дж. Плант Патол. 123, 47–56. doi: 10.1007/s10658-008-9340-z

Полнотекстовая перекрестная ссылка | Академия Google

Остендорп М., Кунц В., Дитрих Б. и Штауб Т. (2001). Индуцированная химией устойчивость растений к болезням. евро. Дж. Плант Патол. 107, 19–28. дои: 10.1023/A:1008760518772

Полнотекстовая перекрестная ссылка | Академия Google

Пастор В., Луна Э., Мауч-Мани Б., Тон Дж. и Флорс В. (2013). Загрунтованные растения не забывают. Окружающая среда.Эксп. Бот. 94, 46–56. doi: 10.1016/j.envexpbot.2012.02.013

Полнотекстовая перекрестная ссылка | Академия Google

Pfaff, MW (2004). Новая математическая модель для относительного количественного определения в ОТ-ПЦР в реальном времени. Рез. нуклеиновых кислот. 29, 2004–2007 гг.

Академия Google

Prime-A-Plant Group: Conrath, U., Beckers, GJM, Flors, V., García-Agustín, P., Jakab, G., et al. (2006). Подготовка: подготовка к бою. Мол. Взаимодействие растительных микробов. 19, 1062–1071. doi: 10.1094/MPMI-19-1062

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Расманн, С., Де Вос, М., Кастил, К.Л., Тиан, Д., Халичке, Р., Сан, Дж.Ю., и соавт. (2012). Травоядные в предыдущем поколении настраивают растения на повышенную устойчивость к насекомым. Завод физиол. 158, 854–863. doi: 10.1104/стр.111.187831

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Райалс, Дж. А., Нойеншванде, У. Х., Уиллитс, М.Г., Молина А., Штайнер Х.-Ю. и Хант М.Д. (1996). Системная приобретенная резистентность. Растительная клетка 8, 1809–1819. doi: 10.1105/tpc.8.10.1809

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шеперс, Х., Андривон, Д., Гоше, Д., Капса, Дж., Лебека, Р., Нильсен, Б., и соавт. (2009). «Результаты тематического исследования картофеля в сети передового опыта ЕС, ENDURE», в специальном отчете № 13 . Материалы 11-го семинара EuroBlight , изд. Х. Т. А. М.Schepers (Норвегия: PPO Publisher), 320.

Академия Google

Шварценбахер, Р. Э., Луна, Э., и Тон, Дж. (2014). Открытие рецептора ВАВА: научные последствия и возможности применения. Фронт. Растениевод. 5:304. doi: 10.3389/fpls.2014.00304

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шарма, К., Бутц, А.Ф., и Финкх, М.Р. (2009). «Genetische Variation in der Resistenzinduktion gegenüber Phytophthora infestans bei Tomaten», in Beiträgezur 10.Wissenschaftstagung ÖkologischerLandbau. Ökologischer Landbau der Zukunft, Zürich, Schweiz , редакторы J. Mayer, T. Alföldi, F. Leiber, D. Dubois, P. Fried, F. Heckendorn и др. (Берлин: д-р Köster Verlag), 11–13.

Шарма, К., Бутц, А.Ф., и Финкх, М.Р. (2010). Влияние генотипов хозяина и патогена на индуцируемость устойчивости томата ( Solanum lycopersicum ) к Phytophthora infestans : индуцированная фитофторозом устойчивость томата. Завод Патол. 59, 1062–1071. doi: 10.1111/j.1365-3059.2010.02341.x

Полнотекстовая перекрестная ссылка | Академия Google

Si-Ammour, A., Mauch-Mani, B., and Mauch, F. (2003). Количественная оценка индуцированной устойчивости к видам Phytophthora , экспрессирующим GFP в качестве жизненно важного маркера: β-аминомасляная кислота, но не BTH, защищает картофель и Arabidopsis от инфекции. Мол. Завод Патол. 4, 237–248. doi: 10.1046/j.1364-3703.2003.00168.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Слотер, А., Даниэль X., Флорс В., Луна Э., Хон Б. и Мауч-Мани Б. (2012). Потомки праймированных растений Arabidopsis проявляют устойчивость к ботическому стрессу. Завод физиол. 158, 835–843. doi: 10.1104/pp.111.1

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Тон, Дж., Якаб, Г., Токуин, В., Флорс, В., Явиколи, А., Медер, М. Н., и соавт. (2005). Анализ феномена прайминга, вызванного β-аминомасляной кислотой, у Arabidopsis . Растительная клетка 17, 987–999.doi: 10.1105/tpc.104.029728

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Тон, Дж., и Мауч-Мани, Б. (2004). Индуцированная β-аминомасляной кислотой резистентность к некротрофным патогенам основана на АБК-зависимом праймировании каллозы. Plant J. Cell Mol. биол. 38, 119–130. doi: 10.1111/j.1365-313X.2004.02028.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

ван Хультен, М., Пельсер, М., ван Лун, Л. К., Питерс, М. Дж.и Тон, Дж. (2006). Затраты и выгоды от подготовки к обороне в Arabidopsis . Проц. Натл. акад. науч. США 103, 5602–5607. doi: 10.1073/pnas.0510213103

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Уолтерс, Д., и Хейл, М. (2007). Затраты и компромиссы, связанные с индуцированной резистентностью. Физиол. Мол. Завод Патол. 71, 3–17. doi: 10.1016/j.pmpp.2007.09.008

Полнотекстовая перекрестная ссылка | Академия Google

Уилсон, Ю.Э. и Коффи, доктор медицины (1980). Цитологическая оценка общей устойчивости к Phytophthora infestans в листве картофеля. Энн. Бот. 45, 81–90.

Академия Google

Worrall, D., Holroyd, G.H., Moore, J.P., Glowacz, M., Croft, P., Taylor, J.E., et al. (2012). Обработка семян активаторами защиты растений формирует длительный затравку устойчивости к вредителям и патогенам. Новый фитол 193, 770–778. doi: 10.1111/j.1469-8137.2011.03987.х

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Йе, Дж., Кулурис, Г., Зарецкая, И., Каткутаче, И., Розен, С., и Мэдден, Т. Л. (2012). Primer-BLAST: инструмент для разработки целевых праймеров для полимеразной цепной реакции. Биоинформатика BMC 13:134. дои: 10.1186/1471-2105-13-134

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Циммерли, Л., Якаб, Г., Метро, ​​Дж. П., и Мауч-Мани, Б. (2000). Потенцирование патоген-специфических защитных механизмов у Arabidopsis β-аминомасляной кислотой. Проц. Натл. акад. науч. США 97, 12920–12925. doi: 10.1073/pnas.230416897

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

.

Добавить комментарий